A comparison of hepatic lipid metabolism and fatty acid composition in muscle between Duroc × Landrace × Yorkshire and Tibetan pigs from three regions

Zhikang Yin; Fan Liu; Xuedong Gu; Li Zhang; Yuan Ma; Miao Zhang; Hui Liu; Jing Yan; Chunbao Li; Zhikang Yin; Fan Liu; Xuedong Gu; Li Zhang; Yuan Ma; Miao Zhang; Hui Liu; Jing Yan; Chunbao Li

doi:10.48130/FMR-2022-0007

Figures (3) Tables (4)

Figure 1.
Differences of liver (up) and serum (down) lipid metabolism between Duroc × Landrace × Yorkshire and Tibetan pigs. GN: Gannan Tibetan pigs; AB: Aba Tibetan pigs; LZ: Nyingchi Tibetan pigs; HA: Duroc × Landrace × Yorkshire pigs. Data are expressed as means ± SD. a, b and c indicate significant differences between different kinds of pigs (P < 0.05).
Figure 2.
Comparison of liver fat distribution of pigs from different regions. To observe slices under a light microscope, the multiple of the eyepiece is 10× and the multiple of the objective lens is 40×. The fat is stained bright red and the nucleus is stained dark blue. GN: Gannan Tibetan pigs; AB: Aba Tibetan pigs; LZ: Nyingchi Tibetan pigs; HA: Duroc × Landrace × Yorkshire pigs.
Figure 3.
Lipid metabolites mRNA expression related genes in liver of Tibetan and Duroc × Landrace × Yorkshire pigs. GN: Gannan Tibetan pigs; AB: Aba Tibetan pigs; LZ: Nyingchi Tibetan pigs; HA: Duroc × Landrace × Yorkshire pigs. Data were presented as the fold change in gene expression normalized to GADPH and relative to HA groups. Data are expressed as means ± SD. a, b and c indicate significant differences between different kinds of pigs (P < 0.05).

Gene	Forward primer	Reverse primer
FAS	5'> TGGGCATGGTGAACTGTCTC<3'	5'>GTCACTGCACCACTTGAGTC<3'
APOE	5'>CCAATCGCAAGCCAGAAGAT<3'	5'>CATCCTGCGAGGAGGGTTAC<3'
APOA1	5'>CTGGGATCGGGTGAAGGATT<3'	5'>AAAGCGGAGGCTTCAAACTG<3'
LDLR	5'>CCGGCAGGAAGAACACTTTC<3'	5'>CTGACAGACAAGCAGATGGC<3'
SCD	5'>CCAGCACTAGTCTACGCTCA<3'	5'>CCCAGGGATGAGACTTCAGG<3'
AGPAT2	5'>GAACGGTGGAGAACATGAGC<3'	5'>ATGCTCTGGTGGTTGGAGAT<3'
LPIN1	5'>GGGAGACAATGGAGAGGCAT<3'	5'>CCGATCCAGGGAGTTCCTTT<3'
PPAR-γ	5'>CCTGAGAAAGCCCTTTGGTG<3'	5'>GGCGGTCTCCACTGAGAATA<3'
CYP7A1	5'>TGTTCAAGACGGGCCACTAT<3'	5'>GAGCGACTTGGCTTTCTCTG<3'
HMGCR	5'>AAACCCTTGGTGGCAGAAAC<3'	5'>TTCTTCATTAGGCCGAGGCT<3'
CPT1A	5'>TGCAGGATACAGCTCCTCTG<3'	5'>CCAGCACATCTGCACTCAAA<3'
LCAT	5'>GAGCTCAGTAACCACACACG<3'	5'>GCTTGGCTTCCAGCTGATTC<3'
GAPDH	5'>TGGAAAGGCCATCACCATCT<3'	5'>ATGGTCGTGAAGACACCAGT<3'

Table 1.

Primer sequences used in quantitative RT-qPCR analyses.

	Duroc × Landrace × Yorkshire pigs	Aba Tibetan pigs	Gannan Tibetan pigs	Nyingchi Tibetan pigs
SOD (U/mgprot)	197.8 ± 4.47^a	198.7 ± 6.82^a	202.5 ± 6.23^a	206.0 ± 8.19^a
T-AOC (mmol/gprot)	0.587 ± 0.04^a	0.529 ± 0.07^ab	0.537 ± 0.06^ab	0.488 ± 0.06^b
MDA (nmol/mg)	2.01 ± 0.15^c	2.45 ± 0.21^a	2.18 ± 0.17^b	2.22 ± 0.19^b
CAT (U/mgprot)	198.0 ± 11.22^b	221.9 ± 7.66^a	211.3 ± 10.53^ab	225.6 ± 6.07^a
Notes: The data are presented as means ± SD. The significance level is set at 0.05. a, b and c superscripts indicate significant differences between the different kinds of pigs in the same row (P < 0.05). SOD: superoxide dismutase; T-AOC: total antioxidant capacity; MDA: malondialdehyde; CAT: catalase.

Table 2.

Liver antioxidant status in different kinds of pigs.

	Duroc × Landrace × Yorkshire pigs	Aba Tibetan pigs	Gannan Tibetan pigs	Nyingchi Tibetan pigs
IMF/%	0.97 ± 0.56^b	2.83 ± 0.80^a	2.79 ± 0.87^a	2.15 ± 0.79^a
liver fat/%	2.03 ± 0.35^a	2.21 ± 0.33^a	1.49 ± 0.29^b	2.19 ± 0.33^a
Notes: The data are presented as means ± SD. The significance level is set at 0.05. a and b superscripts indicate significant differences between the different kinds of pigs in the same row (P < 0.05). IMF: intramuscular fat.

Table 3.

Comparison of IMF and liver fat content in pigs from different regions.

Fatty acid composition	Duroc × Landrace × Yorkshire pigs	Aba Tibetan pigs	Gannan Tibetan pigs	Nyingchi Tibetan pigs
Octanoic acids C8:0	0.01 ± 0.00^b	0.12 ± 0.07^a	0.02 ± 0.01^b	−
Decanoic acid C10:0	0.12 ± 0.02^a	0.12 ± 0.02^a	0.07 ± 0.01^b	0.10 ± 0.01^ab
Lauric acid C12:0	0.10 ± 0.01^a	0.08 ± 0.01^a	0.09 ± 0.02^a	0.09 ± 0.01^a
Myristic acid C14:0	1.57 ± 0.03^a	1.36 ± 0.05^a	1.36 ± 0.29^a	1.55 ± 0.22^a
Pentadecanoic acid C15:0	0.04 ± 0.01^b	0.04 ± 0.01^b	0.11 ± 0.06^a	0.07 ± 0.02^b
Palmitic acid C16:0	26.67 ± 0.48^a	24.96 ± 1.39^a	22.46 ± 2.21^b	25.36 ± 1.49^a
Heptadecanoic acid C17:0	0.20 ± 0.01^b	0.23 ± 0.03^b	0.40 ± 0.15^a	0.32 ± 0.07^ab
Stearic acid C18:0	13.94 ± 0.10^a	11.72 ± 0.25^b	12.14 ± 0.37^b	11.99 ± 0.84^b
Arachidic acid C20:0	0.21 ± 0.02^b	0.21 ± 0.02^b	0.31 ± 0.05^a	0.25 ± 0.04^b
Behenic acid C22:0	0.02 ± 0.00^b	0.12 ± 0.07^a	0.08 ± 0.01^ab	−
Tetracosanoic acid C24:0	−	−	0.17 ± 0.09^b	0.42 ± 0.14^a
Saturated Fatty acid (SFA)	42.87 ± 0.51^a	38.96 ± 1.22^b	37.20 ± 3.19^b	40.13 ± 1.89^ab
9-Tetradecenoic acid C14:1	0.02 ± 0.01^a	0.03 ± 0.01^a	0.03 ± 0.00^a	0.03 ± 0.01^a
15-Tetracosenoic acid C16:1	2.45 ± 0.31^b	3.85 ± 0.44^a	2.10 ± 0.60^b	3.75 ± 0.64^a
10-Heptadecenoic acid C17:1	0.30 ± 0.18^a	0.36 ± 0.18^a	0.46 ± 0.15^a	0.50 ± 0.21^a
Elaidic acid C18:1n9t	−	0.20 ± 0.07^b	1.20 ± 0.09^a	1.36 ± 0.71^a
Oleic acid C18:1n9c	35.48 ± 0.13^b	41.33 ± 1.72^a	35.50 ± 2.70^b	38.76 ± 3.82^ab
Eicosanoic acid C20:1	0.64 ± 0.01^b	0.81 ± 0.04^b	1.25 ± 0.21^a	0.66 ± 0.13^b
Erucic acid C22:1n9	−	−	0.18 ± 0.09	−
Monounsaturated Fatty Acids (MUFA)	38.89 ± 0.75^b	46.58 ± 1.47^a	40.73 ± 2.37^b	45.08 ± 3.78^a
Linoelaidic acid C18:2n6t	0.05 ± 0.01	−	−	−
Linoleic acid C18:2n6c	15.27 ± 1.01^a	11.13 ± 0.89^b	17.06 ± 2.25^a	10.93 ± 3.09^b
11,14-Eicosadienoicacid C20:2	0.59 ± 0.06^b	0.41 ± 0.03^b	0.58 ± 0.11^b	0.30 ± 0.08^b
Linolenic acid C18:3n3	0.90 ± 0.18^b	0.57 ± 0.23^b	2.21 ± 0.47^a	1.94 ± 0.40^a
11,14,17-Eicosatrienoicacid C20:3n6	0.16 ± 0.06^a	0.24 ± 0.05^a	0.23 ± 0.05^a	0.20 ± 0.07^a
8,11,14-Eicosatrienoicacid C20:3n3	0.11 ± 0.02^b	−	0.27 ± 0.05^a	0.22 ± 0.04^a
Arachidonic acid C20:4n6AA	1.06 ± 0.45^a	2.01 ± 0.35^a	1.60 ± 0.59^a	1.30 ± 0.64^a
4,7,10,13,16,19-Docosahexaenoicacid C22:6n3DHA	0.02 ± 0.00^c	0.17 ± 0.03^a	0.17 ± 0.08^a	0.09 ± 0.04^b
Polyunsaturated Fatty acids (PUFA)	18.19 ± 1.15^ab	14.53 ± 0.76^b	22.12 ± 2.68^a	14.98 ± 4.22^b
SFA/UFA	0.75 ± 0.01^a	0.64 ± 0.03^b	0.59 ± 0.08^b	0.67 ± 0.05^ab
PUFA/SFA	0.42 ± 0.03^b	0.37 ± 0.02^b	0.60 ± 0.11^a	0.38 ± 0.12^b
Notes: The data are presented as means ± SD. The significance level is set at 0.05. a and b superscripts indicate significant differences between pork from different regions in the same row (P < 0.05).

Table 4.

Fatty acid composition of longissimus dorsimuscle in different kinds of pigs.