Trimethylamine N-oxide promotes the growth of Chinese mitten crab (<i>Eriocheir sinensis</i>), deposition of amines, and activates the mTOR pathway by affecting metabolism of amino acids

Haokun Hua; Huixing Guo; Wenbin Liu; Zishang Liu; Chaofan He; Yangyang Huang; Xiufei Cao; Wei Xiong; Xi Wang; Yubo Wen; Saiwei Yin; Pengbo Wang; Aimin Wang; Guangzhen Jiang; Haokun Hua; Huixing Guo; Wenbin Liu; Zishang Liu; Chaofan He; Yangyang Huang; Xiufei Cao; Wei Xiong; Xi Wang; Yubo Wen; Saiwei Yin; Pengbo Wang; Aimin Wang; Guangzhen Jiang

doi:10.48130/animadv-0025-0005

Figures (5) Tables (5)

Figure 1.
Effect of dietary TMAO on (a) the enzyme activity of trypsin in the hepatopancreas, (b) the trimethylamine N-oxide demethylase (TMAOase) activity in the hepatopancreas, and (c) the content of flavin monooxygenase 3 (FMO3) in the hepatopancreas. The values are the means ± SEM (n = 3). Different letters indicate significant differences (p < 0.05).
Figure 2.
Effect of dietary TMAO on the value of umami in muscle. The values are the means ± SEM (n = 3). Different letters indicate significant differences (p < 0.05).
Figure 3.
Effect of dietary TMAO on (a) the content of TMAO in muscle, (b) the content of TMAO in the hepatopancreas, (c) the content of TMA in muscle, and (d) the content of TMA in the hepatopancreas. The values are the means ± SEM (n = 3). Different letters indicate significant differences (p < 0.05).
Figure 4.
Effect of dietary TMAO on (a) mammalian target of rapamycin (mTOR), (b) ribosomal protein S6 (S6), (c) ribosomal S6 protein kinase (S6K1), (d) eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1), and (e) eukaryotic translation initiation factor 4E (eIF4E). The values are the means ± SEM (n = 3). Different letters indicate significant differences (p < 0.05).
Figure 5.
Effect of dietary TMAO on mammalian target of rapamycin (mTOR) in muscle. α-TUBULIN is the internal reference protein. The values are the means ± SEM (n = 3).

Ingredients (%)	0% TMAO	0.01% TMAO	0.04% TMAO
Fish meal	25.00	25.00	25.00
Rapeseed meal	2.50	2.50	2.50
Soybean meal	8.00	8.00	8.00
Cottonseed meal	3.00	3.00	3.00
Peanut meal	27.60	27.59	27.56
α-Starch	20.50	20.50	20.50
Fish oil	1.20	1.20	1.20
Soybean oil	3.90	3.90	3.90
Cholesterol	0.20	0.20	0.20
Carboxymethyl cellulose	2.00	2.00	2.00
Ca(H₂PO₄)₂·H₂O	2.20	2.20	2.20
Lecithin	0.20	0.20	0.20
Zeolite	0.40	0.40	0.40
Premix^a	1.00	1.00	1.00
Mixture^b	2.30	2.30	2.30
Trimethylamine N-oxide^c	0.00	0.01	0.04
Total	100.00	100.00	100.00
Proximate composition
Crude protein	36.12	36.09	36.34
^a Premix supplied the following vitamins (IU or mg/kg) and minerals (g/kg): vitamin A, 900,000 IU; vitamin B1, 320 mg; vitamin B2, 1,090 mg; vitamin B5, 2,000 mg; vitamin B6, 500 mg; vitamin B12, 1.6 mg; vitamin C, 10,000 mg; vitamin D, 200,000 IU; vitamin E, 4,500 mg; vitamin K3, 220 mg; pantothenate, 1,000 mg; folic acid, 165 mg; choline, 60,000 mg; biotin, 100 mg; and myoinositol, 15,000 mg; ZnSO₄·7H2O, 22 g; FeSO₄·7H₂O, 25 g; CuSO₄·5H₂O, 2 g; MnSO₄·4H₂O, 7 g; CoCl₂·6H₂O, 0.1 g; KI, 0.026 g; Na₂SeO₃, 0.04 g. ^b Mixture includes the following ingredients (%): mildew-proof agent 2.35%; antioxidants 1.72%; choline chloride 4.75%; Lvkangyuan 59.61%; salt 22.06%; and biostime 9.51%. ^c Trimethylamine N-oxide was purchased from Nanjing Lattice Chemical Technology Co., Ltd, Nanjing, Jiangsu, China.

Table 1.

Ingredient formulation in this feeding trial.

Gene	Position	Primer sequence	Genebank accession	Length	Ref.
mTOR	Forward	AGAAGCTGCATGACTGGGAC	c148249_g1	20	[37]
mTOR	Reverse	CGGTCACACGACACACTGTA	c148249_g1	20	[37]
S6	Forward	TTCCGAGGGTGAACAAGACG	c141087_g1	20	[37]
S6	Reverse	CTGGCCCATACGCTTCTCAT	c141087_g1	20	[37]
S6K1	Forward	TCAATAGCGTCGTCATCG	c74214_g1	18	[37]
S6K1	Reverse	CCCTGCGTGTAGTGGTTG	c74214_g1	18	[37]
4E-BP1	Forward	GCAACACGCCAACTAAACTC	c114480_g1	20	[37]
4E-BP1	Reverse	GCGACACCACCTAATATCCA	c114480_g1	20	[37]
eIF4E	Forward	CAAGGCTGAGCAGGACTTCA	c56848_g1	20	[37]
eIF4E	Reverse	AGCTGATCCAGGTCACAAGC	c56848_g1	20	[37]
β-actin	Forward	TCGTGCGAGACATCAAGGAAA	KM244725.1	21	[38]
β-actin	Reverse	AGGAAGGAAGGCTGGAAGAGTG	KM244725.1	22	[38]
mTOR: mammalian target of rapamycin; S6: ribosomal protein S6; S6K1: ribosomal S6 protein kinase; 4E-BP1: eukaryotic translation initiation factor 4E-binding protein 1; eIF4E: eukaryotic translation initiation factor 4E.

Table 2.

Primer pair sequences and length of the genes used for real-time PCR (qPCR).

Indexs	0% TMAO	0.01% TMAO	0.04% TMAO	p value
SR (%)	60 ± 5.77	66.67 ± 6.67	66.67 ± 13.33	0.844
WGR (%)	114.56 ± 5.00	119.20 ± 8.37	124.98 ± 9.26	0.656
FCR	2.72 ± 0.22^a	2.09 ± 0.05^b	2.02 ± 0.21^b	0.049
FI (g)	117.44 ± 4.53^a	93.46 ± 4.85^b	92.09 ± 2.70^b	0.008
HSI (%)	6.12 ± 0.45	6.17 ± 0.02	5.33 ± 0.56	0.342
CW (cm)	57.35 ± 1.05	58.11 ± 1.04	57.01 ± 1.62	0.826
CL (cm)	52.11 ± 0.23	51.29 ± 1.24	51.86 ± 1.68	0.889
BH (cm)	27.89 ± 0.81	26.38 ± 0.65	27.02 ± 0.71	0.399
SR: survival rate; WGR: weight gain rate; FCR: feed conversion ratio; FI: feed intake; HSI: hepatopancreas somatic indices; CW: carapace width; CL: carapace length; BH: body height. The values are the means ± SEM (n = 3). Values in the same row with different superscripts are significantly different at p < 0.05.

Table 3.

Growth performance of Chinese mitten crab fed experimental diets with different concentrations of trimethylamine N-oxide.

	Muscle
	0% TMAO	0.01% TMAO	0.04% TMAO	p value
Essential amino acid
Threonine	0.54 ± 0.05	0.57 ± 0.01	0.60 ± 0.05	0.610
Valine	0.52 ± 0.04	0.56 ± 0.01	0.60 ± 0.05	0.441
Methionine	0.30 ± 0.03^a	0.31 ± 0.02^a	0.41 ± 0.01^b	0.014
Isoleucine	0.45 ± 0.05	0.53 ± 0.01	0.55 ± 0.04	0.171
Leucine	0.81 ± 0.07	0.92 ± 0.01	0.95 ± 0.07	0.287
Phenylalanine	0.50 ± 0.04	0.53 ± 0.01	0.57 ± 0.06	0.456
Lysine	0.93 ± 0.07	1.01 ± 0.02	1.03 ± 0.08	0.492
Histidine	0.28 ± 0.03	0.29 ± 0.00	0.32 ± 0.03	0.539
Arginine	1.18 ± 0.08	1.24 ± 0.03	1.36 ± 0.09	0.268
Non-essential amino acid
Aspartic acid	1.10 ± 0.08	1.21 ± 0.02	1.26 ± 0.10	0.373
Serine	0.51 ± 0.04	0.54 ± 0.01	0.59 ± 0.05	0.413
Glutamic acid	1.78 ± 0.13	1.95 ± 0.03	2.01 ± 0.15	0.378
Glycine	0.87 ± 0.05	0.90 ± 0.05	0.88 ± 0.02	0.876
Alanine	0.83 ± 0.06	0.91 ± 0.03	0.98 ± 0.12	0.490
Cystine	0.14 ± 0.02	0.14 ± 0.02	0.17 ± 0.02	0.548
Tyrosine	0.40 ± 0.04	0.44 ± 0.02	0.50 ± 0.12	0.278
Proline	0.47 ± 0.06	0.46 ± 0.03	0.51 ± 0.03	0.659
Total	11.61 ± 0.85	12.52 ± 0.29	13.27 ± 1.01
The values are the means ± SEM (n = 4). Values in the same row of each tissue with different superscripts are significantly different at p < 0.05.

Table 4.

Effect on the composition of amino acids in the muscle of Chinese mitten crab fed experimental diets with different concentrations of trimethylamine N-oxide.

Amines	0% TMAO	0.01% TMAO	0.04% TMAO	p value
Spermidine	450.23 ± 51.83^a	372.72 ± 12.41^ab	334.46 ± 19.94^b	0.112
Spermine	88.87 ± 11.95^a	39.39 ± 3.09^b	28.01 ± 1.35^b	0.002
Cadaverine	62.83 ± 7.75	43.58 ± 11.26	34.17 ± 5.31	0.126
Histamine	10.78 ± 0.62	10.48 ± 0.15	10.07 ± 0.07	0.445
Putrescine	345.77 ± 37.71	312.99 ± 70.59	328.98 ± 66.13	0.423
Tyramine	5.89 ± 1.04	6.68 ± 0.78	7.73 ± 0.92	0.421
The values are the means ± SEM (n = 3). Values in the same row of with different superscripts are significantly different at p < 0.05.

Table 5.

Deposition of biogenic amines in muscle of Chinese mitten crab fed experimental diets with different concentrations of trimethylamine N-oxide.