Figures (4)  Tables (8)

    • Figure 1. 

      Effect of incorporating unfermented or fermented palm kernel cake on the jejunum morphology and tight junction protein of finishing pigs. (a) H&E staining of the jejunum tissues. (b)−(d) Gene expression of tight junction protein (claudin-1, occludin, ZO-1).

    • Figure 2. 

      Effect of incorporating unfermented or fermented palm kernel cake into finishing pigs' diets on colonic microbiota diversity (n = 6/treatment). (a)−(d) Alpha diversity index analysis of colon bacterial diversity and richness. (e) Beta diversity analysis of colon microbial community through principal coordinate analysis (PCoA).

    • Figure 3. 

      Effect of incorporating unfermented or fermented palm kernel cake into finishing pigs' diets on colonic bacteria beta diversity at phylum level (n = 6/treatment). (a) Abundance of the colonic microbe phylum level. (b)−(d) Bacteria with differences at the phylum level.

    • Figure 4. 

      Effect of incorporating unfermented or fermented palm kernel cake into finishing pigs' diet on colonic bacteria beta diversity at genus level (n = 6/treatment). (a) Abundance of the colonic microbe genus level. (b) Bacteria with differences at the genus level. a, b Mean that the different superscripts on the figure are significantly different (p < 0.05).

    • Item Diets
      CON1 PKC2 FPKC3
      Ingredients
      Corn 61.80 40.00 39.80
      Soybean meal 14.00 11.00 11.70
      Corn gluten meal 3.00 0.00 0.50
      Soybean oil 3.20 3.00 3.00
      Corn starch 13.00 11.00 10.00
      Fish meal 1.00 1.00 1.00
      Palm kernel cake 0.00 30.00 0.00
      Fermented palm kernel cake 0.00 0.00 30.00
      Premix4 4.00 4.00 4.00
      Total 100.00 100.00 100.00
      Nutrient levels5
      Metabolic energy (MJ/kg) 13.91 13.93 13.96
      Crude protein 13.20 13.30 13.78
      Calcium 0.50 0.51 0.50
      Available phosphorus 0.25 0.26 0.25
      Lysine 0.62 0.61 0.63
      Methionine 0.27 0.25 0.26
      Methionine + cysteine 0.53 0.49 0.50
      Crude ash 4.97 5.84 5.95
      Crude fiber 2.19 5.26 4.48
      Crude fat 4.47 5.03 5.38
      1 CON: control group (basal diet), 2 PKC: unfermented palm kernel cake group (basal diet substituted with 30% of unfermented palm kernel cake diet), 3 FPKC: fermented palm kernel cake group (basal diet substituted with 30% of fermented palm kernel cake diet). 4 The premix provided the following per kg of diet: vitamin A: 100,000 IU, vitamin D3: 30000 IU, vitamin E: 240 IU, vitamin B2: 78 mg, pantothenic acid: 200 mg, nicotinamide: 300 mg, Fe (from ferrous sulfate): 2,000 mg; Cu (from copper sulfate): 100 mg, Mn (from manganese sulfate): 500 mg, Zn (from zinc sulfate): 1,000 mg, I (from calcium iodate): 10 mg, Se (from sodium selenite): 5.0 mg. 5 ME values were calculated from data provided by Feed Database in China (2020).

      Table 1. 

      Chemical composition and nutrient level of different formulae (% of dry matter basis).

    • Gene NCBI gene ID Sequence Product length (bp)
      β-actin XM_021086047.1 F: AACTACCTTCAACTCCATCAT R: GATCTCCTTCTGCATCCTGT 124
      CLAUDIN1 NM_001244539.1 F: CTATGACCCCATGACCCCAG R: GGCCTTGGTGTTGGGTAAGA 150
      OCCLUDIN NM_001163647.2 F: CAGCCTCATTACAGCAGCAGTGG R: TCGCCGCCCGTCGTGTAG 128
      ZO-1 XM_021098856.1 F: CCAGGGAGAGAAGTGCCAGTAGG R: TTTGGTGGGTTTGGTGGGTTGAC 92
      CLAUDIN1: tight junction protein-1, OCCLUDIN: closed protein, ZO-1: zonula occludens1.

      Table 2. 

      Primer sequences for RT-PCR.

    • Items CON1 PKC2 FPKC3 SEM p-value
      IBW (kg) 104.08 104.17 103.75 0.56 0.96
      FBW (kg) 131.92 129.42 130.75 1.04 0.64
      ADFI (g/d) 3,098.94 3,156.66 3,118.22 54.38 0.92
      ADG (g/d) 922.23 841.65 900.00 24.80 0.42
      FCR 3.38b 3.77a 3.48b 0.07 0.03
      1 CON: control group (basal diet), 2 PKC: unfermented palm kernel cake group (contains a 30% unfermented palm kernel cake diet), SEM: standard error of means, 3 FPKC: fermented palm kernel cake group (contains a 30% fermented palm kernel cake diet), SEM: standard error of means. a, b Means in the same row with different superscripts are significantly different (p < 0.05). IBW: initial body weight, FBW: final body weight, ADFI: average daily feed intake, ADG: average daily gain, FCR: feed conversion ratio.

      Table 3. 

      Effect of incorporating unfermented or fermented PKC into finishing pigs' diet on their growth performance (n = 6/treatment).

    • Items CON1 PKC2 FPKC3 SEM p-value
      Dry matter (%) 87.50a 76.69c 80.44b 1.17 < 0.01
      Total energy (%) 86.84a 77.38c 80.66b 1.05 <0.01
      Crude protein (%) 83.95a 64.91b 69.88b 2.17 < 0.01
      Crude fat (%) 88.42 85.25 85.49 0.70 0.12
      Crude fiber (%) 42.09a 30.60b 35.25b 1.51 < 0.01
      Crude ash (%) 45.38a 31.77b 39.75ab 2.11 0.02
      1 CON: control group (basal diet), 2 PKC: unfermented palm kernel cake group (contains a 30% unfermented palm kernel cake diet), 3 FPKC: fermented palm kernel cake group (contains a 30% fermented palm kernel cake diet), SEM: standard error of means. a, b, c Means in the same row with different superscripts are significantly different (p < 0.05).

      Table 4. 

      Effect of incorporating unfermented or fermented PKC into finishing pigs' diet on apparent nutrient digestibility (n = 6/treatment).

    • Items CON1 PKC2 FPKC3 SEM p-value
      TP (g/L) 81.85a 72.68b 78.00ab 1.57 0.05
      ALB (g/L) 39.56 38.23 38.68 0.53 0.62
      GLB (g/L) 42.31a 34.45b 39.32ab 1.18 0.01
      ALB/GLB 0.94b 1.11a 0.99b 0.02 <0.01
      ALT (U/L) 52.84 57.77 54.22 1.40 0.35
      AST (U/L) 62.71 64.77 65.04 2.66 0.93
      AST/ALT 1.21 1.12 1.22 0.06 0.81
      TG (mmol/L) 0.90ab 1.08a 0.75b 0.06 0.04
      TC (mmol/L) 3.58a 3.13ab 2.75b 0.13 0.02
      GLU (mmol/L) 2.38b 2.94b 3.89a 0.19 < 0.01
      1 CON: control group (basal diet), 2 PKC: unfermented palm kernel cake group (contains a 30% unfermented palm kernel cake diet), 3 FPKC: fermented palm kernel cake group (contains a 30% fermented palm kernel cake diet), SEM: standard error of means, TP: total protein, ALB: albumin, GLB: globulin, AST: aspartate aminotransferase, ALT: alanine aminotransaminase, GLU: glucose, TG: triglyceride, TC: total cholesterol. a, b Means in the same row with different superscripts are significantly different (p < 0.05).

      Table 5. 

      Effect of incorporating unfermented or fermented PKC into finishing pigs' diet on serum biochemical variables (n = 6/treatment).

    • Items CON1 PKC2 FPKC3 SEM p-value
      Villus height (μm) 557.08a 473.81b 519.86ab 15.19 0.02
      Crypt depth (μm) 366.15 367.84 356.48 10.08 0.90
      VCR 1.52a 1.29b 1.46a 0.03 < 0.01
      1 CON: control group (basal diet), 2 PKC: unfermented palm kernel cake group (contains a 30% unfermented palm kernel cake diet), 3 FPKC: fermented palm kernel cake group (contains a 30% fermented palm kernel cake diet), SEM: standard error of means, VCR: villi/crypt ratio. a, b Means in the same row with different superscripts are significantly different (p < 0.05).

      Table 6. 

      Effect of incorporating unfermented or fermented PKC into finishing pigs' diet on jejunal morphology (n = 6/treatment).

    • Items CON1 PKC2 FPKC3 SEM p-value
      α-amylase (U/gprot) 164.76a 131.40b 137.07ab 5.84 0.03
      Maltase (U/mgprot) 90.00 86.89 80.24 2.26 0.20
      Sucrase (U/mgprot) 216.43a 175.45b 194.46ab 6.53 0.03
      Trypsin (U/mgprot) 362.61a 290.75b 313.02ab 10.53 < 0.01
      Chymotrypsin (U/mgprot) 4.72a 3.44b 5.11a 0.25 < 0.01
      Lipase (U/mgprot) 54.29b 69.77a 74.86a 2.76 < 0.01
      1 CON: control group (basal diet), 2 PKC: unfermented palm kernel cake group (contains a 30% unfermented palm kernel cake diet), 3 FPKC: fermented palm kernel cake group (contains a 30% fermented palm kernel cake diet), SEM: standard error of means. a, b Means in the same row with different superscripts are significantly different (p < 0.05).

      Table 7. 

      Effect of incorporating unfermented or fermented PKC into finishing pigs' diet on digestive enzyme activity (n = 6/treatment).

    • Items 1CON 2PKC 3FPKC SEM p-value
      Total acid (mM/L) 93.94 101.14 94.57 2.35 0.41
      Acetic acid (mM/L) 56.15 53.65 52.07 1.50 0.56
      Propionic acid (mM/L) 22.00 24.44 22.38 0.62 0.23
      Isobutyric acid (mM/L) 2.98 3.24 3.33 0.22 0.81
      Butyric acid (mM/L) 8.18b 13.80a 11.89ab 0.90 0.02
      Isovaleric acid (mM/L) 2.99 3.64 3.02 0.16 0.19
      Valeric acid (mM/L) 1.63b 2.37a 1.87ab 0.11 < 0.01
      1 CON: control group (basal diet), 2 PKC: unfermented palm kernel cake group (contains a 30% unfermented palm kernel cake diet), 3 FPKC: fermented palm kernel cake group (contains a 30% fermented palm kernel cake diet), SEM: standard error of means. a, b Means in the same row with different superscripts are significantly different (p < 0.05).

      Table 8. 

      Effect of incorporating unfermented or fermented PKC into finishing pigs' diet on colonic short chain fatty acids (n = 6/treatment).