Figures (7)  Tables (2)

    • Figure 1. 

      Phylogenetic, chromosomal localization, and collinearity analysis of EsFAR1/FHY3 gene family. (a) Phylogenetic tree of EsFAR1/FHY3 gene family. The triangle represents EsFAR1/FHY and the asterisk represents AtFAR1/FHY. (b) Location of EsFAR1/FHY3 on chromosomes. (c) Intraspecific collinearity analysis of the EsFAR1/FHY3. (d) Collinearity analysis of species. Green represents FAR1/FHY3 with collinearity, and gray represents other collinearity genes.

    • Figure 2. 

      Gene structure and conserved motif analysis of EsFAR1/FHY3. (a) Distribution of the EsFAR1/FHY3 conserved motifs. (b) Conserved domain of EsFAR1/FHY3. (c) Intron structure of EsFAR1/FHY3. The green box represents an exon. The line represents an intron. (d) Seqlogo of core conserved Motif 2 in EsFAR1/FHY3. (e) Seqlogo of core conserved Motif 2 in AtFAR1/FHY3.

    • Figure 3. 

      Analysis of light response elements of EsFAR1/FHY3 promoter.

    • Figure 4. 

      Effect of light quality on EsFAR1/FHY3 expression. (a) Expression of EsFAR1/FHY3 in transcriptome sequencing results. (b) Expression of EsFAR1/FHY3 was verified by qRT-PCR.

    • Figure 5. 

      Analysis of the binding of EsFAR1/FHY3 to the promoter of E. senticosus saponin synthase gene. (a) Binding site assay. (b) Molecular docking of EsFAR1/FHY3 and EsFPS.

    • Figure 6. 

      MD simulation results of EsFAR1/FHY3 binding to EsFPS promoter. (a) Visualization of MD simulation. (b) RMSD of all atoms in the complex. (c) RMSF of all atoms in the complex. (d) Surface conformation of the complex between 0 and 100 ns.

    • Figure 7. 

      Schematic diagram of EsFAR1/FHY3 regulating the synthesis of E. senticosus saponins in response to light changes.

    • Gene Primer sequences (5'-3') Segment size (bp)
      Cluster-36682.1 CCAAACTCTACCGACAACAT 183
      AACCCACTCTTCTCAACCAG
      Cluster-102049.6 AGCAGACTTGGCGACAGATA 187
      AACCGATAAAGGACTACGAAT
      Cluster-89581.4 TTTTCTATCCGCCGTCATCG 196
      CTCCCAATTCAGTTGTCTTGCTTA
      Cluster-69743.0 CAGTGGCTCCATTCACAGGG 214
      ATACAGTGGCGGGCTTCAGG
      Cluster-102049.5 AGCAGACTTGGCGACAGATA 188
      GAACCGATAAAGGACTACGA
      Cluster-84138.0 ACTATCTTGGTCCACGTTTC 191
      TTCCTGCTTACTGCACTCTG
      Cluster-87448.8 ACTCTTGCGTTTAGTTCCAT 166
      CTCCGTCAGTTCACAGTCTTA
      Cluster-71679.0 TGCTATTGCGGCAGTCTTTC 182
      GCAGTTTCCACCACCTCTTT
      Cluster-89581.3 TTTTCTATCCGCCGTCATCG 196
      CTCCCAATTCAGTTGTCTTGCTTA
      Cluster-89581.5 CCTGGTCATATCCTTCGTCA 207
      CTAAGAATGCCTTCAGTGCC
      Cluster-101653.3 GCACCCAAATTCTCCCGTTCC 152
      TGGCTTAGGGCTATGTCAGG
      Cluster-101653.6 AATGTTACTTCGCCGTCCTC 192
      AATGGGTGGTTGATCGTCTT
      Cluster-96057.0 GTCTAGTAGTCAGCGAGCAG 200
      TAGCCATTTGTCTATCCATC
      Cluster-86052.0 AAAAGTAAGTGTCCCAACCA 157
      GAGTCGCAATGAGAAAGAAG
      Cluster-87127.4 CCAGCCACTTCTCAATCTCA 220
      CTTCATCACCACTACGCATG

      Table 1. 

      qRT-PCR amplification primers of EsFAR1/FHY3 genes.

    • Model Parameter ΔInL Parameter estimation
      M0 41 −17546.660334 ω = 0.12627
      MF 79 −17466.425540 ωA = 0.326188 ωB = 0.168392
      ωC = 0.6544
      M1a 42 −17471.416569 P0 = 0.91334 ω0 = 0.12650
      P1 = 0.08666 ω1 = 1.00000
      M2a 44 −17471.416569 P0 = 0.91334 ω0 = 0.12650
      P1 = 0.08665 ω1 = 1.00000
      P2 = 0.00001 ω2 = 1.00000
      M3 45 −17218.555062 P0 = 0.12241 ω0 = 0.00701
      P1 = 0.41439 ω1 = 0.07580
      P2 = 0.46321 ω2 = 0.23545
      M7 42 −17216.044985 p = 1.10252 q = 6.38677
      M8 44 −17216.046811 p0 = 0.99999 p = 1.10254
      q = 6.38697 p1 = 0.00001
      ω = 1.00000

      Table 2. 

      Adaptive evolutionary analysis of E. senticosus FAR1 / FHY3 gene.