Figures (5)  Tables (3)

    • Figure 1. 

      Root parasites on S. tragus. (a) S. tragus growing in the C. deserticola sowing furrows. (b), (c) S. tragus - root parasite complex. (d) Enlarged view of the root parasite on S. tragus.

    • Figure 2. 

      Transverse section of stem in different Cistanche species. (a) C. deserticola. (b) C. salsa[24]. (c) C. sinensis[24]. (d) C. tubulosa[11]. (e) Cistanche parasitized on S. tragus.

    • Figure 3. 

      Histological characters of the fleshy stems of different varieties of Cistanche. (a) C. deserticola (host: H. ammodendron): 1. epidermis, 2. cortex, 3. vascular bundle, 4. medullary ray, 5. pith. (b) Enlarged view of the vascular bundles of C. deserticola (host: H. ammodendron): 1. vascular bundle sheath, 2. phloem, 3. cambium, 4. xylem, 5. vessel. (c) C. salsa: 1. epidermis, 2. leaf trace bundle, 3. cortex, 4. vascular bundle, 5. medullary ray, 6. pith[3]. (d) Enlarged view of the vascular bundles of C. salsa: 1. vascular bundle sheath, 2. poreline cell, 3. fiber, 4. phloem, 5. vessel, 6. xylem[3]. (e) Cistanche (host: S. tragus): 1. epidermis, 2. cortex, 3. vascular bundle, 4. medullary ray, 5. pith. (f) Enlarged view of the vascular bundles of Cistanche (host: S. tragus): 1. vascular bundle sheath, 2. phloem, 3. cambium, 4. xylem, 5. vessel.

    • Figure 4. 

      Phylogenetic analysis of Cistanche species. (a) Phylogenetic tree based on ITS2 sequences. (b) Phylogenetic tree based on rbcL sequences. (c) Phylogenetic tree based on trnL intron sequences.

    • Figure 5. 

      Major gene divergences among Cistanche species. Cistanche01–03 represents Cistanche (host: S. tragus); C. deserticola01 represents C. deserticola (host: H. ammodendron); C. deserticola02 represents C. deserticola (host: A. canescens). (a) ITS2. (b) rbcL. (c) trnL intron.

    • Collection number Host Collection time Collection location
      SC20240719-1 S. tragus 2024.7.19 Qiemo County, Xinjiang, China
      SC20240719-2 S. tragus 2024.7.19 Qiemo County, Xinjiang, China
      SC20240719-3 S. tragus 2024.7.19 Qiemo County, Xinjiang, China
      HC20240719 H. ammodendron 2024.7.19 Qiemo County, Xinjiang, China
      HC20241021 H. ammodendron 2024.10.21 Jingtai County, Gansu, China
      AC20241021 A. canescens 2024.10.21 Jingtai County, Gansu, China

      Table 1. 

      Details of C. deserticola sample collection.

    • Gene name Primer sequence Reaction conditions
      ITS2 F: ATGCGATACTTGGTGTGAAT
      R: GACGCTTCTCCAGACTACAAT      		 Initial denaturation: 95 °C 3 min;
      Denaturation: 95 °C 15 s;
      Annealing: 60 °C 15 s;
      Extension: 72 °C 60 s;
      Denaturation, annealing and extension were repeated for 35 cycles;
      Final extension: 72 °C
      5 min
      rbcL F: CCAAAGATACTGATATCTTGGCAGCAT
      R: AGACATTCATAAACAGCTCTACCGT
      trnL intron F: CGAAATCGGTAGACGCTACG
      R: GGGGATAGAGGGACTTGAAC

      Table 2. 

      Gene amplification primers and reaction conditions.

    • Sample Echinacoside Acteoside
      C. deserticola01 7.69% 0.29%
      C. deserticola02 5.51% 0.12%
      C. deserticola03 4.36% 0.08%

      Table 3. 

      Concentration of important medicinal components of C. deserticola parasitizing S. tragus.