Figures (9)  Tables (5)

    • Figure 1. 

      Construction of the F2 segregating population and phenotype of pepper

    • Figure 2. 

      Chromosomal localization of the candidate regions by BSA-seq (Δ[SNP index]). (a) Candidate regions identified through SNP association analysis via BSA-seq. (b) Candidate regions identified through small indel association analysis via BSA-seq.

    • Figure 3. 

      Linkage genetic map and LOD score peak map of leaf color mutation in pepper.

    • Figure 4. 

      Variant sites and structural diagram of the candidate gene CaLAP2. (a) Multiple sequence alignment of the CaLAP2 gene region among RY, FY, and FG. (b) Schematic diagram of the CaLAP2 gene structure on Chr09 of pepper.

    • Figure 5. 

      KASP genotyping plot of the CaLAP2 variant's SNPs

    • Figure 6. 

      Phenotype of virus-induced gene silencing

    • Figure 7. 

      Detection of the silencing efficiency of LAP2, with significance at p < 0.05.

    • Figure 8. 

      Detection of chlorophyll content after silencing of CaLAP2. (a) Comparison of chlorophyll a content. (b) Comparison of chlorophyll b content. (c) Comparison of chlorophyll a + b content. (d) Comparison of the chlorophyll a/b ratio. Comparisons are significant at p < 0.05.

    • Figure 9. 

      Detection of photochemical efficiency (Fv/Fm) after silencing CaLAP2

    • ID Position Allele Missing (%) χ2 Pr > χ2
      KASP1 C09-150411 TC 0.50 1.7739 0.411917
      KASP2 C09-277885 AT 0.50 1.6633 0.435327
      KASP3 C09-293859 CT 0.00 2.43 0.296711
      KASP4 C09-390887 AG 5.00 3.2947 0.192556
      KASP5 C09-398468 GT 2.00 0.2755 0.871312
      KASP6 C09-404800 GC 0.50 1.2211 0.543051
      KASP7 C09-585524 GA 4.50 1.6806 0.431575
      KASP8 C09-690139 TC 1.50 2.6041 0.271979
      KASP9 C09-760388 TG 1.00 3.7273 0.155108
      KASP10 C09-832447 CT 1.00 5.1818 0.074953
      KASP11 C09-981827 CA 1.00 3.1616 0.20581
      KASP12 C09-1084701 TC 3.00 5.2887 0.071054
      KASP13 C09-1548432 AT 11.50 1.2712 0.529622
      KASP14 C09-5084723 GA 1.00 5.5556 0.062177
      KASP15 C09-5277105 TA 5.00 0.5684 0.752608
      KASP16 C09-5281991 CA 1.00 2.2828 0.319367
      KASP17 C09-5516629 AG 1.50 1.3959 0.497595
      KASP18 C09-5588330 GA 2.00 4.8469 0.088614
      KASP19 C09-5737361 TC 6.50 3.8984 0.142389
      KASP20 C09-5756188 GC 2.00 1.6735 0.433123
      KASP21 C09-6227942 AG 1.00 3.899 0.142347

      Table 1. 

      Information of 21 SNP markers.

    • Trait name Chromosome Left marker Right marker LOD PVE (%)
      color Chr09 690,139 760,388 122.5747 68.1596
      color Chr09 5,084,723 5,277,105 28.7305 9.0028
      color Chr09 5,281,991 5,516,629 27.1862 7.8642

      Table 2. 

      Fine mapping results of QTLs for leaf color mutation in pepper.

    • Gene ID Start position End position Annotation
      Capana09g000022 711,077 714,954 SPX domain-containing protein 2-like
      Capana09g000023 732,458 735,299 Ethylene-responsive transcription factor WIN1-like isoform X1
      Capana09g000024 746,469 752,891 Elongator complex protein 6
      Capana09g000025 756,104 758,530 Receptor-like protein 12-like
      Capana09g000124 5,083,147 5,088,934 Probable cyclic nucleotide-gated ion channel 5-like isoform X1
      Capana09g000125 5,089,856 5,094,793 Leucine aminopeptidase 2, chloroplastic-like
      Capana09g000126 5,102,001 5,102,363 Uncharacterized protein LOC101267869 isoform X2
      Capana09g000127 5,102,882 5,105,381 Uncharacterized protein LOC102595001 isoform X1
      Capana09g000128 5,109,856 5,112,450 Mary's story protein
      Capana09g000129 5,116,611 5,117,939 BTB/POZ domain-containing protein At4g30940-like
      Capana09g000130 5,210,976 5,212,166 BTB/POZ domain-containing protein At4g30940-like
      Capana09g000131 5,214,327 5,222,692 Elongation factor Ts, mitochondrial-like
      Capana09g000132 5,233,225 5,238,373 Reticulon-like protein B21
      Capana09g000133 5,251,929 5,252,757 CBL-interacting serine/
      threonine-protein kinase 6-like
      Capana09g000134 5,317,930 5,318,742 Zeatin O-glucosyltransferase-like
      Capana09g000135 5,321,977 5,322,318 Zeatin O-glucosyltransferase-like
      Capana09g000136 5,322,794 5,323,186 Zeatin O-glucosyltransferase-like
      Capana09g000137 5,400,159 5,402,583 Serine/threonine-protein kinase At5g01020-like
      Capana09g000138 5,413,772 5,417,555 Sucrose synthase
      Capana09g000139 5,431,595 5,431,927 Cytochrome b6 (chloroplast)
      Capana09g000140 5,455,635 5,459,999 Predicted: 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic-like
      Capana09g000141 5,505,303 5,508,628 20-kDa chaperonin, chloroplastic-like

      Table 3. 

      Information on genes in the mapped interval.

    • ID Primer information
      KASP-LAP2 F1: GAAGGTGACCAAGTTCATGCTgaaaacggactaacctctactC
      F2: GAAGGTCGGAGTCAACGGATTgaaaacggactaacctctactT
      R: catgttcccagtggtggctac

      Table 4. 

      Information of KASP primers developed from the CaLAP2 variants' SNPs.

    • Genotype–phenotype matching Genotype–phenotype mismatch
      TT (yellow) CC (green) TG (green) TT (green) GG (green) TG (yellow) Undetermined (yellow) Undetermined (green)
      F2 45 38 111 0 0 0 1 6
      Maternal parent 1 0 0 0 0 0 0 0
      Paternal parent 0 1 0 0 0 0 0 0

      Table 5. 

      Phenotypic identification of leaf color in parents and the F2 population.