-
Figure 1.
Growth performance and intestinal digestion and absorption. (a) Feeding strategy of M. albus during the experimental period; (b) WGR (%): Weight gain rate = 100 × (Final body weight − Initial body weight) / Initial body weight; (c) FCR: Feed coefficient = Feed weight / (Final body weight − Initial body weight); (d) SR (%): Survival rate = 100 × Final number / Initial number. (e) H&E staining of the intestine. (f) Villus height (VH), μm. (g) Muscular thickness (MT), μm. (h) Goblet cells (GCs) per unit/root. (i) Amylase (AMS), units (U)/mg protein. (j) Lipase (LPS), U/mg protein. (k) Trypsin (TRY), U/mg protein.
-
Figure 2.
Hepatic glycolipid metabolism. (a) Hepatosomatic index (HSI, in %) = 100 × Liver weight / Body weight. (b) HCL, %; (c) HGC, mg/g; (d) serum TG, mmol/L; (e) serum GLU, g/L; (f) GK, U/g protein; (g) PEPCK, U/g protein; (h) PK, U/g protein; (i) G6pase, U/g protein; (j) PFK, U/mg protein; (k) Fbpase, U/g protein. (l) gk: glucokinase; (m) pepck: phosphoenolpyruvate carboxykinase; (n) pk: pyruvate kinase; (o) g6pase: glucose-6-phosphatase; (p) pfk: phosphofructokinase; (q) fbpase: fructose-1,6-bisphosphatase; (r) srebp1: sterol regulatory element-binding protein 1c; (s) acc: acetyl-coa carboxylase; (t) fas: fatty acid synthase; (u) pparα: peroxisome proliferator-activated receptor alpha; (v) aco: acyl-coA oxidase; (w) cpt1: carnitine palmitoyltransferase 1.
-
Figure 3.
Liver tissue injury. (a) Results of H&E staining of the liver: CV, central veins (the veins in the center of the hepatic lobule are surrounded by radial liver cells, which are important vessels for the exchange of substances between the liver and other organs); CN, cell nucleus; VC, vacuolization cell. (b) The number of hepatic cell nuclei; (c) GPT, U/L; (d) GOT, U/L; (e) ROS, U/mg protein; (f) MDA, nmol/mg protein; (g) CAT, U/mg protein; (h) SOD, U/mg protein; (i) GPX, U/mg protein; (j) GSH, μmol/mg protein. (k) nrf2: nuclear factor erythroid 2-related factor; (l) sod: superoxide dismutase; (m) cat: catalase; (n) gpx1: glutathione peroxidase 1; (o) gtsk: glutathione S-transferase kappa; (p) nfkb: nuclear factor kappa b; (q) tlr3: toll-like receptor 3; (r) il1β: interleukin-1 beta.
-
Figure 4.
Characteristics of the gut microbial community structure. (a) Phylogenetic tree constructed based on ASV feature sequences. (b) The upset plot shows the number of ASVs in each group. (c), (d) The Shannon and Simpson indices of alpha diversity. (e), (f) Principal coordinate analysis (PCoA), with two-dimensional (2D) and three-dimensional (3D) plots of samples based on Bray–Curtis distance. (g) The phylum composition of the gut microbiota in each group (top 5). (h) The genus composition of the gut microbiota in each group (top 10).
-
Figure 5.
Identification of core microbes. (a) LEfSe analysis at the phylum level (top 10). (b) LEfSe analysis at the genus level (top 10). (c) LEfSe analysis at the ASV level. (d) Mantel test for specific ASVs (from g_unclassified_Enterobacteriaceae and g_Acinetobacter) and phenotypic indicators.
-
Ingredient CON HC CA1 CA2 Fish meal 40 40 40 40 Wheat gluten 14.46 14.46 14.46 14.46 Corn starch 20 40 40 40 Microcrystalline cellulose 20.5 0.5 0.45 0.3 Fish oil 2 2 2 2 Choline 0.5 0.5 0.5 0.5 Premix1 1 1 1 1 Ca(H2PO4)2 1.5 1.5 1.5 1.5 Antioxidants2 0.01 0.01 0.01 0.01 Mold inhibitor3 0.03 0.03 0.03 0.03 Carnosic acid (CA)4 0 0 0.05 0.2 Nutrition levels4 Crude protein 43.52 43.77 43.89 43.81 Crude lipid 5.92 5.88 5.86 5.91 Ash 9.92 9.73 9.85 9.86 1, Provided by MGO Ter Bio-Tech Co., Ltd. (Qingdao, China). Composition of the vitamin and mineral premix (mg/kg diet): KI (1%), 100 mg; CoCl2·6H2O (1%), 50 mg; CuSO4·5H2O, 4 mg; FeSO4·H2O, 120 mg; ZnSO4·H2O, 60 mg; MnSO4·H2O, 150 mg; Na2SeO3·5H2O (1%), 10 mg; MgSO4·H2O, 30 mg; Vitamin B1, 5 mg; riboflavin, 8 mg; Vitamin B6, 6 mg; Vitamin B12, 0.02 mg; Vitamin K3, 5 mg; inositol, 100 mg; pantothenic acid, 20 mg; niacin acid, 30 mg; folic acid, 1.7 mg; biotin, 0.05 mg; Vitamin A, 15 mg; Vitamin D3, 0.375 mg; Vitamin E, 40 mg; Vitamin C, 100 mg. 2, The main component of the antioxidants is ethoxyquin. 3, The main component of the mold inhibitor is calcium propionate. 4, Purchased from Hunan Zhiyi Biotechnology Co., Ltd (purity ≥ 95%). Table 1.
Composition and nutrient level of the experimental diets (%, dry matter).
-
Gene Forward primer (5'-3') Reverse primer (5'-3') Accession No. rpl17 CGAGAACCCGACTAAATCA GTTGTAGCGACGGAAAGG XM_020587712.1 gk AAGCCATCGTATCCCACC GGGTCCCAGTCCATAGTGT XM_020620531.1 pk CCGCCAAGGGACTGTTT CCACTGGTGGTAAGGACTATG XM_020617665.1 pfk AGCATAGGAGCAGACACCG CACAGAATCCACCCATAGTC XM_020594803.1 pepck CTGTGACGGCTCTGACG ATACATGGTGCGACCTTTC XM_020621224.1 fbpase GGTATGAGGGTCTGTTTAGC GACAGCCACCCAGATGA XM_020616553.1 g6pase GCTGCGGTTGCTGTATG TTCTTGGCGTGTTTATGG XM_020585913.1 srebp1 ATCAGCGGTAAGCCAGTCGG CAGCCACCAGGTCTTTGAGC XM_020616413.1 acc TCTGACAGCGACCCCTTCT GCCCCACACATTCTTATTGC XM_020598745.1 fas CTGTCCGAGGCGGCATAAT CCTGTTCCTTCCCCTTCTGG XM_020608884.1 pparα TGACAGAGTTCGCTAAGGCAGTG CATCTTTGTTCATGCAGGAGGC XM_020621872.1 aco CTTTGGCTCTGTTCTACACCTTG CATGGATGTCAAAGGCATCTACC XM_020610963.1 cpt1 CCTGGAAGAAGCGTGTCATCAGAC TGACTGGCAGGTGCTCCTGTATC XM_020625222.1 nrf2 CTTCAGACAGCGGTGACAGG GCCTCATTCAGTTGGTGCTT XM_020596409.1 sod AGCTGGCTAAGTTCTCATTCAC GCAGTAACATTGCCCAAGTCT XM_020598413.1 cat GTCCAAGTCTAAGGCATCTCC CTCCTCTTCGTTCAGCACC XM_020624985.1 gpx1 GTTCACCGCCAAACTCTT TTCCCATTCACATCTACCTT XM_020607739.1 gstk TTGATGTTCCCCTGCGTTAT CACCTGCTCTACCTGCTTGTC XM_020610780.1 nfκb ACCCTACCGTGACACTAACCT TGCCGTCTATCTTGTGGAAT XM_020616319.1 tlr3 TATTTAGAGCCATACAGGG CACAATCAAGAACGCACA XM_020614353.1 il1β GAGATGTGGAGCCCAAACTT CTGCCTCTGACCTTCTGGACTT KM113037.1 rpl17: ribosomal protein L17; gk: glucokinase; pk: pyruvate kinase; pfk: phosphofructokinase; pepck: phosphoenolpyruvate carboxykinase; fbpase: fructose-1,6-bisphosphatase; g6pase: glucose-6-phosphatase; srebp1: sterol regulatory element-binding protein 1; acc: acetyl-CoA carboxylase; fas: fatty acid synthase; pparα: peroxisome proliferator-activated receptor alpha; aco: acyl-CoA oxidase; cpt1: carnitine palmitoyltransferase 1; nrf2: nuclear factor erythroid 2-related factor 2; sod: superoxide dismutase; cat: catalase; gpx1: glutathione peroxidase 1; gstk: glutathione S-transferase kappa; nfκb: nuclear factor kappa B subunit; tlr3: toll-like receptor 3; il1β: interleukin-1 beta. Table 2.
Real-time PCR primer sequences.
Figures
(5)
Tables
(2)