-
Figure 1.
Combinatorial integration of the cordycepin biosynthetic pathway for enhanced production in S. cerevisiae. (a) Schematic diagram of the cordycepin biosynthesis pathway. Phosphoribosyl pyrophosphate, PRPP; adenosine 5'-monophosphate, 5'-AMP, AMP; adenosine 3'-monophosphate, 3'-AMP. (b) Schematic illustration of multimarker combinatorial integration of the cns1/cns2 expression cassette. Cns1 and Cns2 were connected by a self-cleavable P2A peptide, enabling dual gene expression controlled by a single galactose-inducible promoter (GAL1) promoter.
-
Figure 2.
Allantoin–GAL system for controlling EGFP expression in S. cerevisiae. (a) Schematic illustration of allantoin-inducible EGFP expression in yeast. (b) Growth comparison of JSA-URA-EGFP under different nutrient conditions. The growth curves of JSA-URA-EGFP were obtained in DO-supplemented YNBD medium (blue line), DO-supplemented YABD medium (red line), DO-free YNBD medium (green line) and DO-free YABD medium (orange line). (c) EGFP expression regulated by the allantoin-responsive GAL system in the JSA-URA-EGFP strain. The strain JSA-URA-EGFP was cultivated in YNBD, YABD, and a mixture of 10%YNBD + 90%YABD, and 100 μL of the cell culture was taken for measuring OD600 and EGFP signals with a microplate reader (Biotek, Synergy H1). All experiments were conducted in triplicate, and data represent the mean values with standard deviations. Statistical significance was determined using one-way analysis of variance (ANOVA) followed by Tukey's multiple comparisons test.
-
Figure 3.
Characterization of combinatorial library for cordycepin biosynthesis in S. cerevisiae. (a) Schematic illustration of combinatorial piggyBac transposon-mediated integration of the cns1/cns2 expression cassette using multiple auxotrophic selection markers. (b) Comparative analysis of cordycepin production in 20 strains (JSA-COR-S1~S20) constructed via single-marker piggyBac transposon integration. (c) Representative HPLC results of cordycepin production in engineered strains. (d) Comparative analysis of cordycepin production in 20 strains (JSA-COR-M1~M20) constructed via multimarker integration of the piggyBac transposon. The strain JSA-p426-COR indicates the multicopy episomal plasmid-based engineered strain used for cordycepin biosynthesis. Cordycepin production was screened under a 2-mL fermentation condition. All experiments were conducted in triplicate, and data represent the mean values with standard deviations.
-
Name Description Source p414TEF2-PBase Plasmid carrying a TRP1 marker and a TEF2 promoter-driven PBase [20] pUC18BP-URA3-TEF2-EGFP A transposon plasmid carrying the URA3 selection marker, the TEF2 promoter, the EGFP reporter gene, and inverted terminal repeats (ITRs). [20] pUC18PB-URA3-GAL1-EGFP pUC18BP-URA3-TEF2-EGFP derivative replacing the TEF2 promoter with the GAL1 promoter. This study pUC18PB-LEU2-GAL1-EGFP pUC18PB-URA3-GAL1-EGFP derivative replacing URA3 selection marker with LEU2 This study pUC18PB-HIS3-GAL1-EGFP pUC18PB-URA3-GAL1-EGFP derivative replacing URA3 selection marker with HIS3 This study pUC57-kan-cns1-cns2 Plasmid pUC57-kan derivative with synthesized cns1-P2A-cns2 This study pRS426GAL1-cns1-cns2 Plasmid pRS426GAL1 carrying a URA3 marker and a GAL1 promoter-driven cns1-P2A-cns2 This study pUC18PB-URA3-GAL1-cns1-cns2 pUC18PB-URA3-GAL1-EGFP derivative replacing the EGFP gene with the cns1–P2A–cns2 expression cassette This study pUC18PB-LEU2-GAL1-cns1-cns2 pUC18PB-LEU2-GAL1-EGFP derivative replacing the EGFP gene with the cns1–P2A–cns2 expression cassette This study pUC18PB-HIS3-GAL1-cns1-cns2 pUC18PB-HIS3-GAL1-EGFP derivative replacing the EGFP gene with the cns1–P2A–cns2 expression cassette This study pGAL1_BglII_fwd TTGGTCTCAGATCTACCCTCACTAAAGGGAAC This study marker_SalI_rev AGCGCGTCGACCATGCAGCTCCCGGAGACG This study pUC18PB_SalI_fwd AGCGCGTCGACCATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCACAATATGATTATCTTTCTAGGGCTAATGAGTGAGCTAACTCAC This study pUC18PB_BamHI_rev CGCGGATCCCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTGGCGAATGGCGCCTGATGC This study Table 1.
List of plasmids and oligonucleotides used in this study.
-
Strains Description Source JS-Allan BY4741 Δgal80 pDAL2::GAL4 [22] JSA-p426-COR JS-Allan derivative transformed with pRS426GAL1-cns1-cns2 This study JSA-URA-EGFP These strains represent independent single URA3-marker integrants harboring a GAL1-EGFP expression cassette This study JSA-COR-S1~S20 JS-Allan derivative with single-marker integration of URA3-labeled GAL1-cns1–cns2 expression cassettes This study JSA-COR-M1~M20 JS-Allan derivative with multimarker integration of URA3-, LEU2-, and HIS3-labeled GAL1-cns1–cns2 expression cassettes This study Table 2.
List of strains used in this study.
Figures
(3)
Tables
(2)