Search
2025 Volume 2
Article Contents
RESEARCH ARTICLE   Open Access    

Berberine supplementation enhances antioxidant defense and glucose metabolism in crayfish (Procambarus clarkii) fed a high-carbohydrate diet

More Information
  • Received: 08 January 2025
    Revised: 14 March 2025
    Accepted: 14 April 2025
    Published online: 23 July 2025
    Animal Advances  2 Article number: e020 (2025)  |  Cite this article
  • This study evaluated the impact of berberine (BBR) supplementation on growth, immune function, antioxidant capacity, and glucose metabolism in Procambarus clarkii fed a high-carbohydrate diet (HCD). Crayfish were assigned to three groups: a normal-carbohydrate diet (NCD, 33%), HCD (41%), and HCD with 50 mg/kg BBR (HCB). After an 8-week trial, no significant differences were observed in growth performance or body composition. However, BBR supplementation significantly improved antioxidant capacity by restoring superoxide dismutase (SOD) activity and reducing levels of malondialdehyde (MDA) and glutathione peroxidase (GSH-Px). BBR also mitigated HCD-induced hyperglycemia and hypertriglyceridemia, while increasing hepatic glycogen content and promoting glycolytic enzyme activities (pyruvate kinase and hexokinase). Additionally, BBR elevated the expression of glycogen synthase and glycolysis-related genes (HK, PK, PFK) and decreased gluconeogenesis markers (G6P, PC). These findings suggest that BBR improves glucose metabolism and antioxidant defenses without negatively affecting growth in crayfish fed a high-carbohydrate diet. The abstract graphic is shown in Supplementary Fig. S1.
  • 加载中
  • Supplementary Fig. S1 Abstract graphic for this study.
  • [1] FAO. 2024. The state of world fisheries and aquaculture 2024: Blue Transformation in action. Rome: FAO. doi: 10.4060/cd0683en
    [2] Oficialdegui FJ, Sánchez MI, Clavero M. 2020. One century away from home: how the red swamp crayfish took over the world. Reviews in Fish Biology and Fisheries 30:121−35 doi: 10.1007/s11160-020-09594-z

    CrossRef   Google Scholar

    [3] Wang Q, Lin Y, Zhang H, Fan W, Li S, et al. 2024. Positive impacts of dietary prebiotic inulin on growth performance, antioxidant capacity, immunity, and intestinal microbiota of red swamp crayfish (Procambarus clarkii). Aquaculture International 32:775−94 doi: 10.1007/s10499-023-01188-3

    CrossRef   Google Scholar

    [4] Singha KP, Sahu NP, Sardar P, Shamna N, Kumar V. 2024. A strategic roadmap for carbohydrate utilization in crustaceans feed. Reviews in Aquaculture 16:674−705 doi: 10.1111/raq.12861

    CrossRef   Google Scholar

    [5] Zhou CP, Ge XP, Liu B, Xie J, Miao LH. 2013. Effect of high dietary carbohydrate on the growth performance and physiological responses of juvenile Wuchang bream, Megalobrama amblycephala. Asian-Australasian Journal of Animal Sciences 26:1598−608 doi: 10.5713/ajas.2012.12659

    CrossRef   Google Scholar

    [6] Encarnação P. 2016. Functional feed additives in aquaculture feeds. In Aquafeed Formulation, ed. Nates SF. US: Academic Press. pp. 217−37. doi: 10.1016/B978-0-12-800873-7.00005-1
    [7] Kussmann M, Abe Cunha DH, Berciano S. 2023. Bioactive compounds for human and planetary health. Frontiers in Nutrition 10:1193848 doi: 10.3389/fnut.2023.1193848

    CrossRef   Google Scholar

    [8] Tian J, Gao WH, Wen H. 2018. Research advances: intestinal health and feed additives in aquatic animals. Chinese Journal of Animal Nutrition 30:7−13 (in Chinese) doi: 10.3969/j.issn.1006-267x.2018.01.002

    CrossRef   Google Scholar

    [9] Doan HV, Hoseinifar SH, Jaturasitha S, Dawood MAO, Harikrishnan R. 2020. The effects of berberine powder supplementation on growth performance, skin mucus immune response, serum immunity, and disease resistance of Nile tilapia (Oreochromis niloticus) fingerlings. Aquaculture 520:734927 doi: 10.1016/j.aquaculture.2020.734927

    CrossRef   Google Scholar

    [10] Wang L, Sun Y, Xu B, Sagada G, Chen K, et al. 2020. Effects of berberine supplementation in high starch diet on growth performance, antioxidative status, immune parameters and ammonia stress response of fingerling black sea bream (Acanthopagrus schlegelii). Aquaculture 527:735473 doi: 10.1016/j.aquaculture.2020.735473

    CrossRef   Google Scholar

    [11] Pan H, Li Z, Xie J, Liu D, Wang H, et al. 2019. Berberine influences blood glucose via modulating the gut microbiome in grass carp. Frontiers in Microbiology 10:1066 doi: 10.3389/fmicb.2019.01066

    CrossRef   Google Scholar

    [12] Xu WN, Chen DH, Chen QQ, Liu WB. 2017. Growth performance, innate immune responses and disease resistance of fingerling blunt snout bream, Megalobrama amblycephala adapted to different berberine-dietary feeding modes. Fish & Shellfish Immunology 68:458−65 doi: 10.1016/j.fsi.2017.07.051

    CrossRef   Google Scholar

    [13] Gao C, Wang L, Wang H, Wang L, Wang CY, et al. 2025. Prefeeding of berberine alleviates waterborne copper-induced hepatic oxidative stress, lipid deposition, and intestinal microbiota dysbiosis in yellow catfish (Pelteobagrus fulvidraco). Aquaculture 594:741443 doi: 10.1016/j.aquaculture.2024.741443

    CrossRef   Google Scholar

    [14] Liu H, Wei M, Tan B, Dong X, Xie S. 2024. The supplementation of berberine in high-carbohydrate diets improves glucose metabolism of tilapia (Oreochromis niloticus) via transcriptome, bile acid synthesis gene expression and intestinal flora. Animals 14:1239 doi: 10.3390/ani14081239

    CrossRef   Google Scholar

    [15] Lu KL, Zhang DD, Wang LN, Xu WN, Liu WB. 2016. Molecular characterization of carnitine palmitoyltransferase IA in Megalobrama amblycephala and effects on its expression of feeding status and dietary lipid and berberine. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 191:20−25 doi: 10.1016/j.cbpb.2015.08.010

    CrossRef   Google Scholar

    [16] Tian J, Xiao W, Zhang J, Xu L, Li M, et al. 2024. Dietary phosphatidylcholine requirements of red swamp crayfish (Procambarus clarkii). Aquaculture International 32:6115−32 doi: 10.1007/s10499-024-01458-8

    CrossRef   Google Scholar

    [17] Association of Official Analytical Chemists (AOAC). 1997. Official Methods of Analysis of AOAC International. Gaithersburg (Maryland): AOAC International. www.aoac.org/official-methods-of-analysis
    [18] Roehrig KL, Allred JB. 1974. Direct enzymatic procedure for the determination of liver glycogen. Analytical Biochemistry 58:414−21 doi: 10.1016/0003-2697(74)90210-3

    CrossRef   Google Scholar

    [19] Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 25:402−8 doi: 10.1006/meth.2001.1262

    CrossRef   Google Scholar

    [20] Jiang H, Qian Z, Lu W, Ding H, Yu H, et al. 2015. Identification and characterization of reference genes for normalizing expression data from red swamp crawfish Procambarus clarkii. International Journal of Molecular Sciences 16:21591−605 doi: 10.3390/ijms160921591

    CrossRef   Google Scholar

    [21] Kari ZA, Téllez-Isaías G, Khoo MI, Wee W, Kabir MA, et al. 2024. Resveratrol impacts on aquatic animals: a review. Fish Physiology and Biochemistry 50:307−18 doi: 10.1007/s10695-024-01319-4

    CrossRef   Google Scholar

    [22] Sampath WWHA, Rathnayake RMDS, Yang M, Zhang W, Mai K. 2020. Roles of dietary taurine in fish nutrition. Marine Life Science & Technology 2:360−75 doi: 10.1007/s42995-020-00051-1

    CrossRef   Google Scholar

    [23] Huang CC, Sun J, Ji H, Kaneko G, Xie XD, et al. 2020. Systemic effect of dietary lipid levels and α-lipoic acid supplementation on nutritional metabolism in zebrafish (Danio rerio): focusing on the transcriptional level. Fish Physiology and Biochemistry 46:1631−44 doi: 10.1007/s10695-020-00795-8

    CrossRef   Google Scholar

    [24] Askari VR, Khosravi K, Baradaran Rahimi V, Garzoli S. 2024. A mechanistic review on how berberine use combats diabetes and related complications: molecular, cellular, and metabolic effects. Pharmaceuticals 17:7 doi: 10.3390/pharmaceutics17010007

    CrossRef   Google Scholar

    [25] Utami AR, Maksum IP, Deawati Y. 2023. Berberine and its study as an antidiabetic compound. Biology 12:973 doi: 10.3390/biology12070973

    CrossRef   Google Scholar

    [26] He C, Jia X, Zhang L, Gao F, Jiang W, et al. 2021. Dietary berberine can ameliorate glucose metabolism disorder of Megalobrama amblycephala exposed to a high-carbohydrate diet. Fish Physiology and Biochemistry 47:499−513 doi: 10.1007/s10695-021-00927-8

    CrossRef   Google Scholar

    [27] Kamalam BS, Medale F, Panserat S. 2017. Utilisation of dietary carbohydrates in farmed fishes: new insights on influencing factors, biological limitations and future strategies. Aquaculture 467:3−27 doi: 10.1016/j.aquaculture.2016.02.007

    CrossRef   Google Scholar

    [28] Hemre GI, Mommsen TP, Krogdahl Å. 2002. Carbohydrates in fish nutrition: effects on growth, glucose metabolism and hepatic enzymes. Aquaculture Nutrition 8:175−94 doi: 10.1046/j.1365-2095.2002.00200.x

    CrossRef   Google Scholar

    [29] Schirf VR, Turner P, Selby L, Hannapel C, Cruz PDL, et al. 1987. Nutritional-status and energy-metabolism of crayfish (Procambarus-Clarkii, Girard) muscle and hepatopancreas. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 88:383−86 doi: 10.1016/0300-9629(87)90050-8

    CrossRef   Google Scholar

    [30] Shi HJ, Xu C, Liu MY, Wang BK, Liu WB, et al. 2018. Resveratrol improves the energy sensing and glycolipid metabolism of blunt snout bream Megalobrama amblycephala fed high-carbohydrate diets by activating the AMPK-SIRT1-PGC-1α network. Frontiers in Physiology 9:1258 doi: 10.3389/fphys.2018.01258

    CrossRef   Google Scholar

    [31] Ren G, Guo JH, Qian YZ, Kong WJ, Jiang JD. 2020. Berberine improves glucose and lipid metabolism in HepG2 cells through AMPKα1 activation. Frontiers in Pharmacology 11:647 doi: 10.3389/fphar.2020.00647

    CrossRef   Google Scholar

    [32] Rong Q, Han B, Li Y, Yin H, Li J, et al. 2021. Berberine reduces lipid accumulation by promoting fatty acid oxidation in renal tubular epithelial cells of the diabetic kidney. Frontiers in Pharmacology 12:729384 doi: 10.3389/fphar.2021.729384

    CrossRef   Google Scholar

    [33] He L, Zhou X, Huang N, Li H, Tian J, et al. 2017. AMPK regulation of glucose, lipid and protein metabolism: mechanisms and nutritional significance. Current Protein & Peptide Science 18:562−70 doi: 10.2174/1389203717666160627071125

    CrossRef   Google Scholar

    [34] Ming JH, Wang T, Wang TH, Ye JY, Zhang YX, et al. 2023. Effects of dietary berberine on growth performance, lipid metabolism, antioxidant capacity and lipometabolism-related genes expression of AMPK signaling pathway in juvenile black carp (Mylopharyngodon piceus) fed high-fat diets. Fish Physiology and Biochemistry 49:769−86 doi: 10.1007/s10695-022-01143-8

    CrossRef   Google Scholar

    [35] Lin SM, Shi CM, Mu MM, Chen YJ, Luo L. 2018. Effect of high dietary starch levels on growth, hepatic glucose metabolism, oxidative status and immune response of juvenile largemouth bass, Micropterus salmoides. Fish & Shellfish Immunology 78:121−26 doi: 10.1016/j.fsi.2018.04.046

    CrossRef   Google Scholar

    [36] Wu C, Ye J, Gao JE, Chen L, Lu Z. 2016. The effects of dietary carbohydrate on the growth, antioxidant capacities, innate immune responses and pathogen resistance of juvenile Black carp Mylopharyngodon piceus. Fish & Shellfish Immunology 49:132−42 doi: 10.1016/j.fsi.2015.12.030

    CrossRef   Google Scholar

    [37] Zhang BY, Cai GH, Yang HL, Nie QJ, Liu ZY, et al. 2024. New insights on intestinal microorganisms and carbohydrate metabolism in fish. Aquaculture International 32:2151−70 doi: 10.1007/s10499-023-01262-w

    CrossRef   Google Scholar

    [38] Bai N, Zhang W, Mai K, Wang X, Xu W, et al. 2010. Effects of discontinuous administration of β-glucan and glycyrrhizin on the growth and immunity of white shrimp Litopenaeus vannamei. Aquaculture 306:218−24 doi: 10.1016/j.aquaculture.2010.06.017

    CrossRef   Google Scholar

    [39] Yoshida T, Kruger R, Inglis V. 1995. Augmentation of non-specific protection in African catfish, Clarias gariepinus (Burchell), by the long-term oral-administration of immunostimulants. Journal of Fish Diseases 18:195−98 doi: 10.1111/j.1365-2761.1995.tb00278.x

    CrossRef   Google Scholar

    [40] Haftcheshmeh SM, Abedi M, Mashayekhi K, Mousavi MJ, Navashenaq JG, et al. 2022. Berberine as a natural modulator of inflammatory signaling pathways in the immune system: Focus on NF-κB, JAK/STAT, and MAPK signaling pathways. Phytotherapy Research 36:1216−30 doi: 10.1002/ptr.7407

    CrossRef   Google Scholar

  • Cite this article

    Wen C, Jia X, Zhu C, Fang X, Tian H, et al. 2025. Berberine supplementation enhances antioxidant defense and glucose metabolism in crayfish (Procambarus clarkii) fed a high-carbohydrate diet. Animal Advances 2: e020 doi: 10.48130/animadv-0025-0018
    Wen C, Jia X, Zhu C, Fang X, Tian H, et al. 2025. Berberine supplementation enhances antioxidant defense and glucose metabolism in crayfish (Procambarus clarkii) fed a high-carbohydrate diet. Animal Advances 2: e020 doi: 10.48130/animadv-0025-0018

Figures(2)  /  Tables(5)

Article Metrics

Article views(1961) PDF downloads(844)

RESEARCH ARTICLE   Open Access    

Berberine supplementation enhances antioxidant defense and glucose metabolism in crayfish (Procambarus clarkii) fed a high-carbohydrate diet

Animal Advances  2 Article number: e020  (2025)  |  Cite this article

Abstract: This study evaluated the impact of berberine (BBR) supplementation on growth, immune function, antioxidant capacity, and glucose metabolism in Procambarus clarkii fed a high-carbohydrate diet (HCD). Crayfish were assigned to three groups: a normal-carbohydrate diet (NCD, 33%), HCD (41%), and HCD with 50 mg/kg BBR (HCB). After an 8-week trial, no significant differences were observed in growth performance or body composition. However, BBR supplementation significantly improved antioxidant capacity by restoring superoxide dismutase (SOD) activity and reducing levels of malondialdehyde (MDA) and glutathione peroxidase (GSH-Px). BBR also mitigated HCD-induced hyperglycemia and hypertriglyceridemia, while increasing hepatic glycogen content and promoting glycolytic enzyme activities (pyruvate kinase and hexokinase). Additionally, BBR elevated the expression of glycogen synthase and glycolysis-related genes (HK, PK, PFK) and decreased gluconeogenesis markers (G6P, PC). These findings suggest that BBR improves glucose metabolism and antioxidant defenses without negatively affecting growth in crayfish fed a high-carbohydrate diet. The abstract graphic is shown in Supplementary Fig. S1.

    • Aquaculture has increasingly become a vital contributor to global food security, with the cultivation of various crustacean species such as crayfish (Procambarus clarkii) experiencing rapid expansion[1]. As consumer demand for crayfish continues to increase, the imperative to enhance crayfish health and nutrition through optimized management strategies becomes more pronounced. A critical factor influencing crayfish growth, health, and overall metabolism is the composition of their diet[2,3]. Specifically, crayfish, like other aquatic species, require carefully balanced diets to support their metabolic needs, immune function, and resistance to disease. Among the macronutrients, carbohydrates are a significant component of crayfish feed and serve as an essential energy source[4]. However, high-carbohydrate diets, while cost-effective and energy-rich, pose a challenge to crayfish metabolism[4]. Excessive carbohydrate intake can cause metabolic imbalances, impair growth performance, and increase susceptibility to stress and disease[4,5].

      As consumer demand for crayfish continues to increase, the imperative to enhance crayfish health and nutrition through optimized management strategies becomes more pronounced One promising approach involves supplementing natural bioactive compounds that regulate metabolic pathways and enhance physiological resilience[68]. Among these compounds, berberine (BBR), an isoquinoline alkaloid derived from various medicinal plants, has garnered significant attention for its broad-spectrum biological activities, particularly in improving glucose and lipid metabolism, reducing oxidative stress, and enhancing immune function[9,10]. While extensively studied in mammalian models, recent research has demonstrated its efficacy in aquatic species, such as grass carp (Ctenopharyngodon idella), where BBR enhances glycolytic enzyme activity to lower blood glucose and lipid levels[11]. In blunt snout bream (Megalobrama amblycephala), it significantly boosts antioxidant defenses by increasing superoxide dismutase and glutathione peroxidase activities, thereby mitigating oxidative stress-induced damage[12]. Moreover, studies on yellow catfish (Pelteobagrus fulvidraco) indicate that BBR enhances immune function by promoting the proliferation of beneficial probiotic bacteria, leading to a healthier gut microbiome[13], while in Nile tilapia (Oreochromis niloticus), it improves growth performance by enhancing feed utilization and metabolic efficiency[14]. These findings suggest that BBR may exert similar benefits in crayfish, particularly in high-carbohydrate diets that can induce metabolic imbalances. By facilitating carbohydrate utilization, regulating key metabolic pathways, and strengthening antioxidant and immune defenses, BBR has the potential to enhance growth, health, and resilience, offering a promising dietary intervention in crayfish aquaculture.

      Although BBR has shown promising effects in modulating metabolism and enhancing immune function in various species, the exact mechanisms by which it influences crayfish metabolism, particularly in the context of a high-carbohydrate diet are not yet fully understood. Clarifying these mechanisms is essential for developing effective dietary strategies that can optimize crayfish health and productivity, especially in aquaculture systems where high-carbohydrate diets are commonly employed for cost efficiency. Moreover, with increasing concerns about the environmental sustainability of aquaculture practices, identifying natural, safe, and cost-effective supplements that can improve feed efficiency and reduce disease prevalence is becoming more critical[4].

      This study seeks to evaluate the effects of BBR supplementation on the metabolic and immune responses of P. clarkii fed a high-carbohydrate diet, with a specific focus on glucose and lipid metabolism, oxidative stress markers, and immune-related gene expression. By analyzing these physiological parameters, we aim to determine whether BBR can mitigate the negative impacts of excessive carbohydrate intake, thereby enhancing crayfish health. The findings of this research could provide valuable insights into crayfish nutrition, contributing to the development of more health-conscious dietary formulations in aquaculture. As the industry continues to expand, functional feed additives like BBR may play a crucial role in promoting animal health, reducing reliance on chemical treatments, and improving sustainability. Ultimately, this research seeks to advance our understanding of bioactive compounds in aquaculture diets, with the broader goal of optimizing productivity while safeguarding the welfare of cultured species.

    • The formulation and composition of the experimental diets are summarized in Table 1, where corn starch was employed as the principal carbohydrate source to adjust carbohydrate levels. Three specific dietary treatments were designed for this study: a normal carbohydrate diet (NCD) with 33% carbohydrates, a high carbohydrate diet (HCD) containing 41% carbohydrates, and a high carbohydrate diet supplemented with BBR (HCB), which consisted of 41% carbohydrates plus 50 mg/kg of BBR. The BBR was supplied by Nanjing Chunqiu Biotechnology Co., Ltd., China, and its dosage was selected based on prior studies conducted in our laboratory[15].

      Table 1.  Formulation and proximate composition of the experimental diets.

      NCD HCD HCB
      Ingredients (% dry weight)
      Fish meal 14.80 14.80 14.80
      Soybean meal 19.80 19.80 19.80
      Peanut meal 11.88 11.88 11.88
      Cottonseed meal 11.88 11.88 11.88
      Corn starch 17.06 25.18 25.18
      α-starch 4.96 4.96 4.96
      Fish oil 3.25 3.25 3.25
      Beef tallow 3.25 3.25 3.25
      Calcium dihydrogen phosphate 2.20 2.20 2.20
      Sodium chloride 0.40 0.40 0.40
      Premixa 1.00 1.00 1.00
      Chitin 0.15 0.15 0.15
      Cholesterol 0.10 0.10 0.10
      Lecithin 0.15 0.15 0.15
      Microcrystalline cellulose 8.12 0 0
      BBR 0 0 0.005
      Sodium carboxymethyl cellulose 0.50 0.50 0.50
      Ethoxyquin 0.50 0.50 0.50
      Proximate analysis (%)
      Water content 10.71 10.25 10.43
      Crude protein 31.11 30.42 30.47
      Crude lipid 6.78 7.15 6.86
      Crude ash 7.65 7.51 7.79
      Carbohydrate 32.43 40.88 40.91
      Energy 19.46 19.87 19.85
      a The micronutrients contained in the premix are as follows: vitamins (mg or IU/kg) include: CoCl2·6H2O, 0.1 g; MnSO4·4H2O, 7g; KI, 0.026 g; FeSO4·7H2O, 25 g; Na2SeO3, 0.04 g; ZnSO4·7H2O, 22 g; CuSO4·5H2O, 2 g; minerals (g/kg) include :Vitamin A, 1,500,000 IU; Vitamin E, 5,000 mg; Vitamin K3, 220 mg; Vitamin B2, 1090 mg; Vitamin B12, 15 mg; Vitamin B1, 320 mg; Vitamin B5, 2,000 mg; Vitamin B6, 500 mg; Vitamin C, 14,000 mg; Pantothenate, 1,000 mg; Folic acid, 230 mg; Choline, 60,000 mg; Biotin, 130 mg; Myoinositol 45,000 mg; Niacin, 3,000 mg; Vitamin D, 200,000 IU. Calculated by difference (100 - moisture - crude protein - crude lipid - ash - crude fiber).

      All ingredients were carefully weighed and mixed to ensure uniform distribution, then passed through a 0.25 mm mesh for consistency. The mixture was subsequently processed into pellets using a single-screw meat grinder (JR-32, Baicheng Co., Guangzhou, China). These pellets were air-dried for 24 h in a well-ventilated space, broken into sizes suitable for crayfish consumption, vacuum-sealed in plastic bags, and stored at −20 °C until feeding.

    • The crayfish used in this study were sourced from a commercial aquaculture facility located in Pukou City, Jiangsu Province, China. After a one-week acclimatization period, during which the crayfish were fed a commercially available diet from Haipurui Feed Co., Ltd. (Taizhou, Jiangsu) that closely mirrors the nutritional profile of the NCD diet, a total of 168 crayfish with an average initial body weight of 14.1 g were selected for the feeding trial. These crayfish were then randomly distributed across 12 cement tanks, each measuring 1.0 m in length, width, and height. Each tank housed 14 crayfish, composed of seven males and seven females, and the experimental design incorporated four replicates per treatment group.

      The crayfish were fed twice daily, with a feeding rate equivalent to 3%−5% of their body mass. The feeding period lasted for eight weeks, during which the crayfish were reweighed every two weeks to accurately adjust the feeding quantity based on their growth. To ensure optimal water conditions, water changes were performed every three days, with one-third of the tank's water volume being replaced each time. In conjunction with water changes, uneaten feed, and waste material were removed from the tanks. Key water quality parameters, including temperature, pH, dissolved oxygen, and ammonia nitrogen levels, were regularly monitored and maintained within the following ranges: maintaining a temperature of 28 ± 2 °C, pH at 7.39 ± 0.13, dissolved oxygen at 5.72 ± 0.36 mg/L, and ammonia nitrogen concentrations kept below 0.05 mg/L. This meticulous management of water quality and feeding practices ensured a controlled environment for evaluating the effects of dietary interventions on crayfish health.

    • After the eight-week feeding trial, five crayfish were randomly selected from each treatment group and anesthetized by placing them on ice. Hemolymph was collected from each crayfish using a 2-ml syringe preloaded with 1 ml of anticoagulant solution (0.14 M NaCl, 0.1 M glucose, 30 mM trisodium citrate, 26 mM citric acid, and 10 mM EDTA, pH 4.6), which was inserted into the pericardial cavity to extract 1 ml of hemolymph. The collected hemolymph was transferred into a centrifuge tube, and centrifuged at 3,000 g for 10 min at 4 °C[16]. The resulting supernatant was carefully collected and stored at −80 °C for subsequent biochemical analyses.

      After hemolymph extraction, the crayfish were dissected to collect tissue samples. Both the hepatopancreas and muscle tissues were harvested, with portions immediately stored at −80 °C for long-term preservation, while other sections were stored at −20 °C for additional analyses. This comprehensive sampling ensured the collection of high-quality biological materials for assessing the physiological and metabolic impacts of the dietary treatments, particularly the influence of BBR supplementation on crayfish under a high-carbohydrate diet.

    • The growth performance of crayfish was assessed using several key metrics, including mass gain rate (MGR), specific growth rate (SGR), feed conversion ratio (FCR), survival rate (SR), hepatopancreas index (HI), and meat yield (MY). These parameters were calculated using the following equations:

      $ \mathrm{MGR\,({\text{%}} )=(Mt-M0)\times 100/T} $
      $ \mathrm{SGR\, (\text{%}\; day^{-1})=(LnWt-LnW0)\times100/T} $
      $ \mathrm{SR\, (\text{%})=Final\; crayfish\; number/Initial\; crayfish\; number\times100} $
      $ \mathrm{FCR\, (\text{%})=Feed\; intake/Total\; wet\; weight\; gain} $
      $ \mathrm{HI\, ({\text{%}})=(Hepatopancreas\; weight/Body\; weight)\times100} $
      $ \mathrm{MY\,({\text{%}} )=Muscle\;weight/Wt} $

      T is the rearing duration in days. The total feed intake was estimated based on the calculated feeding regime, provided as a fixed proportion of the crayfish body weight throughout the experiment.

    • The proximate composition of crayfish and experimental diets was determined using standardized methods as outlined by the Association of Official Analytical Chemists[17]. The moisture content was determined by drying the sample to a constant weight at 105 °C. Crude protein content was measured via an automated Kjeldahl nitrogen analysis system (KT260; Foss, Zürich, Switzerland). Crude ash content was determined after combusting the samples in a muffle furnace at 550 °C for 4 h. Ether extraction using the Soxhlet method was employed to quantify crude lipid content, while crude fiber was measured using a glass crucible method with an automated fiber analyzer (ANKOM A2000i, USA). Total energy content was determined using a bomb calorimeter (Parr 1281; Parr Instrument Company, Moline, IL, USA), ensuring a comprehensive assessment of the nutritional composition of both feed and crayfish samples.

    • To evaluate the immune response and antioxidant defenses of crayfish, several key enzymatic activities were measured in the hemolymph and hepatopancreas using commercial kits from the Jiancheng Bioengineering Institute (Nanjing, China). Hemolymph samples were analyzed for acid phosphatase (ACP; Cat. No. A060-2), alkaline phosphatase (AKP; Cat. No. A059-1), alkaline phosphatase (ALP; Cat. No. A059-2), aspartate aminotransferase (AST; Cat. No. A010-2), and alanine aminotransferase (ALT; Cat. No. A009-2). In hepatopancreas tissue, superoxide dismutase (SOD; Cat. No. A001-3), glutathione peroxidase (GSH-px; Cat. No. A005-1), and malondialdehyde (MDA; Cat. No. A003-1) levels were measured, assessing the oxidative stress and antioxidant capacity of crayfish.

      The assays were carried out following the manufacturers' protocols, with enzyme activity measured through colorimetric analysis, and the absorbance readings taken using a UV-visible spectrophotometer. These measurements allowed for precise quantification of the crayfish's physiological response to the experimental diets, particularly regarding immune competence and oxidative stress management.

    • Glucose metabolism was assessed by measuring glucose (Cat. No. A006-1), triglyceride (Cat. No. A110-1), and total cholesterol (Cat. No. A111-1) concentrations in hemolymph samples using commercially available kits from Jiancheng Bioengineering Institute (Nanjing, China). Glycolytic enzyme activity was evaluated by analyzing pyruvate kinase (PK) and hexokinase (HK) activities in the hepatopancreas, with a UV spectrophotometer used to determine their kinetic profiles.

      Glycogen levels in tissues were determined following the method of Roehrig & Allred[18]. Total RNA was extracted from hepatopancreas samples using the RNAiso Plus Kit (Cat. No. 9109, TaKaRa, Co. Ltd., Dalian, China) as per the manufacturer's instructions. The quality and concentration of RNA were assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). RNA purity was confirmed by analyzing the absorbance ratio at 260 and 280 nm, and RNA integrity was evaluated via formaldehyde denaturation agarose gel electrophoresis.

      Complementary DNA (cDNA) synthesis was conducted using the PrimeScript™ RT Master Mix Kit (Cat. No. RR036A, TaKaRa, Co. Ltd., Dalian, China), following the manufacturer's instructions. The cDNA was diluted in diethylpyrocarbonate-treated water and used as the template for quantitative PCR. Real-time PCR reactions were conducted using the TB Green™ Premix Ex Taq™ (Tli RNaseH Plus) Kit (Cat. No. RR420A, TaKaRa, Co. Ltd.) on an ABI7300 real-time PCR system (Applied Biosystems, Foster City, CA, USA). Each PCR reaction was prepared in a 20 μL volume, comprising 10 μL of TB Green™ Premix, 0.8 μL each of forward and reverse primers (10 μM), 0.4 μL of ROX reference dye (50×), 2.0 μL of cDNA template, and 6.0 μL of distilled water. The amplification protocol consisted of an initial denaturation step at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. Specificity was verified via melting curve analysis and agarose gel electrophoresis. Gene expression was quantified using the 2−ΔΔCᴛ method[19], with eukaryotic translation initiation factor (EIF) serving as the reference gene[20]. All primer sequences used for quantitative PCR are presented in Table 2.

      Table 2.  Primer sequences for real-time fluorescence quantification of PCR.

      Target gene Primer sequence (5'-3') Amplicon size (bp)
      GLUT1 F: TTTTCGAGTTCGTCGGAGGG 100
      R: ATCTGGCCGCAGTACACAAA
      Gys F: AGCTTCGCTGAAGGGAACAA 197
      R: CACAGCTTGGCTTGGAACAC
      HK F: GTGGGGTGCGTTTGGAGATA 147
      R: ACCTCCCGATACAGGTCTCC
      PK F: AGCGGACTGTGTCATGTTGT 76
      R: ATTAGCCATTGTTCGCACGC
      PFK F: GGAATGTACGTAGGGGCTCG 151
      R: CCTTGCACCTAGCTGAACCA
      PEPCK F: TGTCCCATCATTGACCCTGC 120
      R: GTGCTTCCAGTCGTAGGCTT
      G6P F: CGGAGCGGACTGTTCTTCAT 143
      R: TTGGACCACTCGCAGAAGAC
      PC F: ACTCCCCAGGGATGTGCTAT 130
      R: AAGCACCGTCAAGGCGAATA
      Glucose transporter 1, GLUT 1; Glycogen synthase, Gys; Hexokinase, HK; Pyruvate kinase, PK; Phosphofructokinase, PFK; Phosphoenolpyruvate carboxykinase, PEPCK; Glucose-6-phosphatase, G6P; Pyruvate carboxylase, PC.
    • Data are presented as mean ± standard error of the mean (SEM). One-way analysis of variance (ANOVA) was applied to compare data from the NCD, HCD, and HCB treatment groups, followed by Tukey's post-hoc test to assess statistical significance between means. Statistical significance was set at p < 0.05. All statistical analyses were performed using SPSS software (version 24.0; SPSS Inc., Chicago, IL, USA).

    • To assess the impact of BBR supplementation on the growth performance of crayfish subjected to a HCD, an 8-week feeding experiment was conducted using three dietary treatments: NCD, HCD, and HCB. Several growth parameters were analyzed, including initial and final weights, FCR, SR, WGR, SGR, HI, and MY, as shown in Table 3. Although crayfish fed with the HCD exhibited a trend of reduced growth performance compared to those on the NCD, these differences did not reach statistical significance. However, the addition of BBR in the HCB group appeared to mitigate some of the negative impacts associated with the HCD, though these improvements were not statistically significant.

      Table 3.  Growth performance of Procambarus clarkii.

      Parameter NCD HCD HCB
      IM (g) 14.19 ± 0.13 14.29 ± 0.14 14.22 ± 0.22
      FM (g) 29.92 ± 0.54 29.11 ± 0.48 29.14 ± 0.76
      FCR 2.67 ± 0.08 2.87 ± 0.16 2.87 ± 0.14
      SR (%) 100 ± 0.00 94.64 ± 3.42 98.21 ± 1.79
      MGR (%) 112.01 ± 2.03 104.30 ± 5.24 105.86 ± 6.21
      SGR (% day−1) 1.33 ± 0.19 1.27 ± 0.02 1.28 ± 0.07
      HI (%) 4.81 ± 0.23 4.47 ± 0.22 4.72 ± 0.10
      MY (%) 10.02 ± 0.18 10.42 ± 0.28 9.92 ± 0.20
      IM, initial body mass; FM, final body mass; FCR, feed conversion ratio; SR, Survival rate; MGR, mass gain rate; SGR, specific growth rate; HI, hepatopancreas index; MY, meat yield. There were no significant differences by ANOVA.
    • The proximate composition of the crayfish body was analyzed, and the results are presented in Table 4. Neither the increase in dietary carbohydrate levels nor the inclusion of BBR in the HCB diet produced significant changes in the body composition of crayfish. Measured components such as crude protein, crude fat, ash, and moisture content remained comparable across all dietary treatments, indicating that BBR supplementation did not induce any measurable alterations in nutrient storage or allocation in the crayfish body.

      Table 4.  Body composition of Procambarus clarkii (wet mass basis, %).

      Whole-body composition NCD HCD HCB
      Water content 67.06 ± 1.11 67.26 ± 1.82 65.61 ± 1.42
      Crude protein 12.84 ± 0.02 12.05 ± 0.03 12.14 ± 0.22
      Crude lipid 2.40 ± 0.16 2.27 ± 0.11 2.17 ± 0.06
      Crude ash 11.89 ± 0.07 12.20 ± 0.56 12.43 ± 0.25
      Energy 14.70 ± 0.02 15.15 ± 0.19 14.70 ± 0.14
      There were no significant differences among the groups by ANOVA.
    • To explore the potential of BBR in counteracting the immune and oxidative stress impairments caused by an HCD, a range of immunological and antioxidant parameters were evaluated (Table 5). No significant changes were observed in hemolymph levels of AKP, ACP, ALT, and AST among the different diet groups. However, the antioxidant activity, particularly SOD, was significantly reduced in the HCD group compared to the NCD group, suggesting oxidative stress induced by the high carbohydrate intake. Notably, BBR supplementation in the HCB group significantly restored SOD activity to near-normal levels, mitigating the oxidative damage observed in the HCD group. Additionally, MDA and GSH-px activities were significantly elevated in the HCD group relative to the NCD group (p < 0.05), but BBR supplementation effectively reduced these elevated levels, indicating improved antioxidant defenses in crayfish fed the HCB diet.

      Table 5.  The immunity and antioxidant capacity of Procambarus clarkii.

      Parameter NCD HCD HCB
      Hemolymph
      ACP (KA unit/100 ml) 2.08 ± 0.07 1.93 ± 0.09 2.01 ± 0.06
      AKP (KA unit/100 ml) 1.28 ± 0.05 1.20 ± 0.05 1.28 ± 0.09
      ALT (U/L) 17.81 ± 0.62 19.46 ± 0.45 19.12 ± 0.68
      AST (U/L) 1.26 ± 0.17 1.49 ± 0.14 1.28 ± 0.20
      Hepatopancreas
      SOD (U/mg protein) 53.08 ± 1.09a 46.28 ± 1.47b 55.90 ± 2.45a
      GSH-px (U/mg protein) 2.27 ± 0.24a 5.03 ± 0.26b 2.67 ± 0.56a
      MDA (nmol/mg protein) 2.27 ± 0.24a 5.03 ± 0.26b 2.67 ± 0.56a
      ACP, phosphatase; AKP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; SOD, superoxide dismutase; GSH-px, glutathione peroxidase; MDA, malondialdehyde. Means in the same rows with different superscripts were significantly different (p < 0.05) by ANOVA.
    • The effects of dietary treatments on hemolymph biochemical markers were also investigated. Crayfish fed the HCD exhibited significantly elevated blood glucose and TG levels compared to those in the NCD group, suggesting that excessive carbohydrate intake negatively affected glucose and lipid metabolism (Fig. 1a, b). Interestingly, BBR supplementation in the HCB group significantly reduced both blood glucose and TG levels, indicating an amelioration of the metabolic disturbances induced by the HCD. No significant changes in total cholesterol were detected across all dietary groups (Fig. 1c).

      Figure 1. 

      Effect of BBR on blood biochemistry and glycolysis in Procambarus clarkii. (a), glucose (GLU) in the hemolymph, (b) triglyceride (TG) in the hemolymph, (c) total cholesterol (TC) in the hemolymph, (d) hepatopancreatic glycogen, (e) muscle glycogen, (f) hexokinase (HK) in the hepatopancreas, and (g) pyruvate kinase (PK) in the hepatopancreas. The notable difference of the means of each group in the same indicator is represented by different lowercase letters (p < 0.05) by ANOVA.

      Muscle glycogen content showed no statistically significant differences between treatments, though an increasing trend was observed across the HCD and HCB groups (Fig. 1e). In contrast, liver glycogen content was significantly higher in crayfish fed the HCD compared to those on the NCD (Fig. 1d), suggesting enhanced glycogen storage in the hepatopancreas as a result of carbohydrate overconsumption. Furthermore, BBR supplementation further increased liver glycogen storage compared to the HCD group alone. Consistent with these observations, the activities of key glycolytic enzymes, PK and HK, were significantly elevated in the hepatopancreas of crayfish fed the HCD relative to the NCD group (Fig. 1f, g). Notably, BBR supplementation resulted in a further increase in the activities of PK and HK, indicating an enhanced glycolytic flux in response to BBR in crayfish fed a high-carbohydrate diet.

    • The expression of genes involved in carbohydrate metabolism was assessed in the hepatopancreas to further elucidate the mechanisms by which BBR influences metabolic responses (Fig. 2). The mRNA expression of glycogen synthase (Gys), a key enzyme in glycogen synthesis, was significantly upregulated in the HCD group compared to the NCD group. Moreover, BBR supplementation in the HCB group further enhanced Gys expression compared to the HCD group alone, suggesting that BBR promotes glycogen accumulation (p < 0.05, Fig. 2a). Glucose transporter 1 (GLUT1) expression was also higher in both the HCD and HCB groups than in the NCD group (p < 0.05, Fig. 2b), indicating increased glucose uptake in response to higher carbohydrate intake.

      Figure 2. 

      Effect of BBR on glucose metabolism related genes in the hepatopancreas of Procambarus clarkii. (a) Glycogen synthase (Gys), (b) glucose transporter 1 (Glut1), (c) hexokinase (HK), (d) pyruvate kinase (PK), (e) phosphofructokinase (PFK), (f) phosphoenolpyruvate carboxykinase, (PEPCK), (g) glucose-6-phosphatase (G6P), and (h) pyruvate carboxylase (PC). The notable difference in the means of each group of the same indicator is represented by different lowercase letters (p < 0.05) by ANOVA.

      The mRNA expression of other glycolytic enzymes, including hexokinase (HK), pyruvate kinase (PK), and phosphofructokinase (PFK), did not differ significantly between the NCD and HCD groups. However, these genes showed a notable increase in expression in the HCB group compared to both the NCD and HCD groups (Fig. 2ce), implying that BBR supplementation enhances glycolytic activity at the transcriptional level.

      Conversely, genes associated with gluconeogenesis, such as glucose-6-phosphatase (G6P) and pyruvate carboxylase (PC), showed no significant differences in expression between the NCD and HCD groups (Fig. 2g, h). However, their expression levels were significantly reduced in the HCB group, suggesting that BBR suppresses gluconeogenic activity in crayfish fed a high-carbohydrate diet. Similarly, the expression of phosphoenolpyruvate carboxykinase (PEPCK), another key enzyme in gluconeogenesis, followed a similar trend, although the differences were not statistically significant across the groups (Fig. 2f).

    • While high-carbohydrate (HC) diets offer economic advantages in aquaculture, numerous studies have documented their adverse effects on aquatic species, particularly concerning metabolism and growth[4]. Additives such as resveratrol, taurine, and alpha-lipoic acid have been investigated for their potential to alleviate HC diet-induced metabolic disturbances, particularly in glucose metabolism, insulin sensitivity, and lipid accumulation[2123]. However, side effects such as increased fat deposition limit their long-term application[2123]. In contrast, BBR, a bioactive compound extensively studied in mammals, shows promise for improving metabolic health due to its broad bioactivity and minimal side effects[24]. In mammalian models, BBR has been shown to regulate energy metabolism, improve blood glucose control, enhance lipid metabolism, and reduce inflammation, primarily through activation of the AMP-activated protein kinase (AMPK) pathway[25]. Its role in reducing hepatic lipid accumulation and improving insulin sensitivity supports its potential as a functional feed additive[13,14]. However, studies on BBR in aquatic species, particularly crustaceans, remain limited. Aquatic species, with generally lower carbohydrate utilization capacities, are more prone to metabolic disorders such as glucose intolerance and lipid accumulation when fed HC diets[4]. In species like Nile tilapia, BBR has demonstrated the potential to improve glucose and lipid metabolism, enhance growth performance, and boost antioxidant capacity[9]. This study is the first to investigate the metabolic effects of BBR in crayfish, addressing a significant gap in the literature.

      Our study assessed whether BBR supplementation could mitigate the negative effects of HC diets on crayfish growth performance. Results indicated no significant differences in key growth parameters, including SGR, WGR, FCR, and SR, among crayfish fed a NCD, HCD, and HCB. These findings align with previous research on other species, such as M. amblycephala and C. idella, where BBR showed no significant impact on growth performance[11,26]. This lack of effect could be due to an insufficient BBR dosage or the possibility that BBR's influence is more pronounced in metabolic regulation than growth promotion.

      While not statistically significant, the HCD group exhibited a trend of reduced growth, consistent with studies suggesting that excessive carbohydrate intake can disrupt metabolic homeostasis and impair growth[27]. HC diets are known to cause glucose intolerance and lipid accumulation, which can hinder optimal growth[28]. The absence of growth improvement in the HCB group suggests that BBR's effects, under the conditions tested, may be more focused on metabolic regulation rather than directly enhancing growth[25]. Additionally, the distinct metabolic and physiological characteristics of crayfish, compared to fish, may account for the lack of growth enhancement[29]. Further research is required to optimize BBR dosage, supplementation strategies, and environmental conditions to fully explore its potential benefits for crayfish growth performance.

      The body composition analysis confirmed that BBR supplementation did not significantly affect nutrient storage and utilization in crayfish, with no notable differences in crude protein, lipid, moisture, or ash content among groups. These results are consistent with findings in M. amblycephala and black seabream, suggesting that BBR has limited effects on body composition in aquatic species[10,12]. The key takeaway is BBR's neutral impact on lipid accumulation, avoiding excessive fat deposition commonly seen with other metabolic regulators such as resveratrol or alpha-lipoic acid[23,30]. While these regulators may improve glucose metabolism, their tendency to promote fat accumulation limits broader use in aquaculture. In contrast, BBR's neutral effect on lipid storage suggests it may serve as a safer long-term supplement, without compromising nutritional efficiency in aquaculture systems. Thus, BBR holds promise, particularly for balancing growth performance and metabolic regulation.

      Further investigation into BBR's metabolic effects revealed its significant role in mitigating metabolic imbalances induced by HC diets. Crayfish in the HCB group showed significantly lower blood glucose and TG levels compared to the HC group, highlighting BBR's role in addressing metabolic disturbances. These findings are consistent with previous studies demonstrating BBR's broad effects on glucose and lipid metabolism. For example, Liu et al. reported that BBR significantly reduced blood glucose and improved lipid metabolism in Nile tilapia[14]. In this study, the upregulation of genes associated with glucose metabolism, such as GLUT1 and Gys, in the HCB group suggests that BBR enhances energy utilization in crayfish by promoting glucose uptake and glycogen storage. These metabolic improvements may not only counteract the negative effects of HC diets but also support better growth performance in aquatic animals.

      Although the specific molecular mechanisms of BBR in crayfish were not fully explored in this study, it is likely that BBR acts through pathways similar to those seen in mammals. In mammalian models, BBR activates the AMPK signaling pathway, a key regulator of cellular energy balance that responds to energy deficiency or metabolic stress. AMPK activation promotes glucose uptake, glycogen synthesis, and fatty acid oxidation while inhibiting lipid synthesis[31]. Previous studies have shown that BBR lowers blood glucose and improves lipid metabolism in mammals and fish through AMPK activation[31,32]. In our study, the increased expression of glycolytic enzymes such as HK and PK, as well as Gys, in the HCB group suggests a similar AMPK-dependent mechanism in crayfish[33]. This mechanism reinforces the potential of BBR as a functional additive in aquaculture, mitigating the metabolic stresses of HC diets in aquatic species.

      Another key finding of this study was the enhancement of antioxidant capacity. BBR supplementation significantly restored SOD activity and lowered MDA levels, indicating a substantial reduction in oxidative stress induced by HC diets. This is consistent with Ming et al. in Juvenile Black Carp, where BBR improved antioxidant capacity and reduced oxidative stress markers[34]. These results suggest that BBR helps alleviate HC diet-induced oxidative stress by modulating antioxidant defense mechanisms, thereby improving crayfish resilience to environmental stress. Interestingly, BBR supplementation did not significantly affect immune-related indicators in crayfish, which aligns with previous studies[35,36]. Moderate carbohydrate intake can enhance immune function, but excessive intake may impair it[37]. The absence of immune function enhancement could also be attributed to immune fatigue, a phenomenon where prolonged exposure to immune stimulants leads to weakened immune responses over time[12,38]. Research in shrimp and other crustaceans suggests that intermittent supplementation with immune-enhancing compounds may be more effective than continuous feeding[38,39]. This approach could potentially improve the immunomodulatory effects of BBR in crayfish. Future studies should explore optimal supplementation protocols, including frequency and dosage, to determine whether BBR can enhance immune function in crayfish. Although no significant changes in immune-related enzyme expression were observed, the improvement in antioxidant defenses suggests that BBR may still contribute to enhanced immune resilience. Previous research has shown that BBR can modulate immune responses by reducing inflammatory markers and enhancing immune cell activity, potentially increasing disease resistance in aquatic species[40].

      Overall, this study has important implications for aquaculture, especially in improving crayfish health under HC diets. BBR improved glucose utilization, reduced lipid accumulation, and enhanced antioxidant defenses, highlighting its potential as a functional feed additive to counter the negative effects of HC diets. By improving metabolic efficiency and reducing oxidative stress, BBR may enhance overall health and disease resistance in crayfish, potentially improving growth performance and reducing disease risks. Additionally, BBR's regulation of glucose and lipid metabolism without significantly altering body composition suggests it is a safe and sustainable option for improving crayfish growth performance and survival, ultimately enhancing the economic efficiency and sustainability of crayfish aquaculture.

      Future research should further evaluate BBR's effects across various aquatic species and explore its long-term impact and dose-response relationships. Investigations into the feasibility of large-scale commercial application of BBR, including its economic viability, environmental impact, and stability during feed processing, are also necessary.

    • In conclusion, although BBR supplementation did not significantly improve growth performance in crayfish fed an HC diet, it played a crucial role in regulating glucose and lipid metabolism, enhancing glycogen storage, and improving antioxidant defenses. These metabolic improvements suggest that BBR could be a valuable tool for mitigating the negative effects of HC diets in aquaculture. Future research should explore the long-term effects of BBR supplementation and optimize its dosage and application methods to maximize its benefits in crayfish and other aquatic species. By advancing our understanding of bioactive compounds in aquaculture, this study contributes to the development of more sustainable and health-oriented feeding strategies.

    • All experimental procedures involving animals were reviewed and preapproved by the Institutional Animal Care and Use Committee (IACUC) at Nanjing Agricultural University (Permit number: IACUC2019548, approval date: 2020.09). The study strictly followed institutional and international ethical guidelines for animal research. The research also adhered to the principles of Replacement, Reduction, and Refinement to minimize animal harm. Details regarding animal housing, care, and pain management are provided to ensure minimal impact on the animals during the experiment.

      • This work was supported by the Jiangsu Agricultural Industry Technology System (Grant Nos JATS [2023] 471 and JATS [2023] 441).

      • The authors confirm their contributions to the paper as follows: conceptualization: Wen C, Zhang D; methodology: Wen C, Jia X, Zhu C; investigation, formal analysis: Wen C; visualizations: Wen C, Ma S; writing - draft manuscript preparation: Wen C, Jia X, Tian H; software: Jia X, Zhu C, Tian H, Ma S, Jiang W; data analysis: Jia X, Ma S, Jiang W; validation: Tian H; funding acquisition: Wang A (lead), Liu W; funding securing, project administration: Zhang D; resources: Wang A, Liu W; study design: Wang A; project supervision: Liu W, Zhang D; writing - critical reviews: Fang X; writing - manuscript editing: Fang X, Zhang D. All authors reviewed the results and approved the final version of the manuscript.

      • The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

      • The authors declare no conflicts of interest that could have affected the outcomes or interpretations presented in this work. Dingdong Zhang is the Editorial Board member of Animal Advances who was blinded from reviewing or making any decisions on this manuscript. The article followed the journal's standard procedures, with peer review conducted independently of this Editorial Board member and the research groups.

      • Copyright: © 2025 by the author(s). Published by Maximum Academic Press on behalf of Nanjing Agricultural University. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (2)  Table (5) References (40)
  • About this article
    Cite this article
    Wen C, Jia X, Zhu C, Fang X, Tian H, et al. 2025. Berberine supplementation enhances antioxidant defense and glucose metabolism in crayfish (Procambarus clarkii) fed a high-carbohydrate diet. Animal Advances 2: e020 doi: 10.48130/animadv-0025-0018
    Wen C, Jia X, Zhu C, Fang X, Tian H, et al. 2025. Berberine supplementation enhances antioxidant defense and glucose metabolism in crayfish (Procambarus clarkii) fed a high-carbohydrate diet. Animal Advances 2: e020 doi: 10.48130/animadv-0025-0018

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return