Figures (2)  Tables (14)

    • Figure 1. 

      Effect of mannanase addition to the diet with 17.83% SBM content on ileal microflora of broilers at 21 d. (a) In this study, the Greengenes database was used as the basis for species-level classification of ASVs using sklearn, followed by species screening to retain Bacteria and Archaea. The top 5 species in terms of relative abundance at the phylum level and the top 10 species in relative abundance at the genus level were analyzed in the form of (b), (c) bar charts; and (d) venn diagrams were used to represent the two groups of endemic and shared features. (e), (f) The relative abundance of differential ASVs at the phylum level and genus level of ileum was screened by volcano plots from DESeq2 analysis using 17.83% SBM group as control and 17.83% SBM + 100 mg/kg mannanase as the treatment group, respectively. (g)−(k) The alpha diversity was expressed as simpson’s index, shannon index, observed_features, faith_pd and Chao1, and the microorganisms were subjected to (l), (m) NMDS and PCoA based on weighted Unifrac distances to express the beta diversity, respectively. (n) The correlation coefficients of the features were calculated and the nodes with significantly correlated features were connected to plot the network graphs of the Spearman’s correlation analysis at the genus level. (o), (p) Based on the relative abundance and sequence of ASVs in the samples, PICRUSt2 was used to predict the macrogenomic results at the level of the KEGG-L3 and CAZymes, respectively, while the comparative analyses were performed to analyze the differences between the groups.

    • Figure 2. 

      Effect of mannanase addition to the diet with 17.83% SBM content on cecal microflora of broilers at 21 d. (a) In this study, the Greengenes database was used as the basis for species-level classification of ASVs using sklearn, followed by species screening to retain Bacteria and Archaea. (b), (c) The top five species in terms of relative abundance at the phylum level and the top 10 species in relative abundance at the genus level were analyzed in the form of bar charts; and (d) venn diagrams were used to represent the two groups of endemic and shared features. (e), (f) The relative abundance of differential ASVs at the phylum level and genus level of cecum was screened by volcano plots from DESeq2 analysis using 17.83% SBM group as control and 17.83% SBM + 100 mg/kg mannanase as the treatment group, respectively. (g) - (k) The alpha diversity was expressed as simpson’s index, shannon index, observed_features, faith_pd, and Chao1, and the microorganisms were subjected to (l), (m) NMDS and PCoA based on weighted Unifrac distances to express the beta diversity, respectively. (n) The correlation coefficients of the features were calculated and the nodes with significantly correlated features were connected to plot the network graphs of the Spearman’s correlation analysis at the genus level. (o) Based on the relative abundance and sequence of ASVs in the samples, PICRUSt2 was used to predict the macrogenomic results at the level of the KEGG-L3 and CAZymes, respectively, while the comparative analyses were performed to analyze the differences between the groups.

    • Item Day 0 to 21 Day 22 to 42
      35.66% SBM group 17.83% SBM group 8.92% SBM group 30.58% SBM group 15.29% SBM group 7.65% SBM group
      Composition ratio (%)
      Corn (7.8% CP) 54.00 59.82 59.91 58.17 62.78 65.73
      SBM (44% CP) 35.66 17.83 8.92 30.58 15.29 7.65
      DCP 10.00 12.00 9.65 13.18
      CGM 3.24 6.00 10.44 3.17 5.15 7.11
      Soybean oil 2.76 1.15 1.02 4.46 3.20 2.25
      L-lysine hydrochloride (98.5%) 0.12 0.45 0.60 0.16 0.37 0.50
      Calcium hydrogen phosphate 1.84 1.96 2.10 1.51 1.55 1.53
      Stone powder 1.25 1.36 1.34 1.26 1.32 1.37
      NaCl 0.39 0.39 0.43 0.24 0.24 0.25
      Trace mineral feedb 0.20 0.20 0.20 0.10 0.10 0.10
      Choline chloride (50%) 0.20 0.20 0.20 0.10 0.10 0.10
      DL-Methionine (99%) 0.21 0.22 0.17 0.14 0.13 0.11
      L-Tryproan 0.10 0.12
      L-Threonine 0.20 0.21
      Antioxidants 0.05 0.05 0.05 0.05 0.05 0.05
      Vitamin premixc 0.03 0.03 0.03 0.02 0.03 0.03
      Phytase 0.02 0.02 0.02 0.02 0.02 0.02
      Zeolite 0.02 0.02 2.24 0.02 0.02 0.02
      Calculated nutrient levels
      ME, Mcal/kg 2.95 2.95 2.95 3.10 3.10 3.10
      CP 22.13 22.13 22.12 20.19 20.19 20.19
      Ca 1.01 1.05 1.05 0.92 0.93 0.93
      Available phosphorus 0.45 0.47 0.49 0.39 0.40 0.40
      Lysine 1.20 1.25 1.22 1.10 1.11 1.12
      Methionine 0.56 0.59 0.56 0.46 0.47 0.47
      Tryproan 0.18 0.25 0.24
      Threonine 0.72 0.86 0.85
      a The feed was in granular form. b The analytical values for each kg of trace mineral feed ingredients were presented as follows: Cu 8 g; Fe 40 g; Zn 55 g; Mn 60 g; I 750 mg; Se 150 mg; Co 250 mg; moisture ≤ 10%. c The analytical values for each kg of vitamin premix composition were presented as follows: vitamin A 50 million IU; vitamin D3 12 million IU; vitamin E 100,000 IU; vitamin K3 10 g; vitamin B1 8 g; vitamin B2 32 g; vitamin B6 12 g; vitamin B12 100 mg; nicotinamide 150 g; D-pantothenic acid 46 g; folic acid 5 g; biotin 500 mg; moisture ≤ 6%.

      Table 1. 

      Composition and proportions of experimental dietsa (%, as is basis).

    • Items 35.66% SBM 17.83% SBM 8.92% SBM
      ME (Mcal/kg) 2.94 2.94 2.97
      NE (Mcal/kg) 2.23 2.35 2.22
      Digestible lysine 1.20 1.18 1.17
      Digestible methionine 0.50 0.55 0.53
      Digestible threonine 0.77 0.82 0.84
      Digestible tryptophan 0.17 0.25 0.24
      Digestible arginine 1.32 1.37 1.30
      Digestible leucine 1.76 1.71 1.78
      Digestible isoleucine 0.69 0.64 0.61
      Digestible histidine 0.42 0.45 0.43
      Digestible phenylalanine 0.91 0.92 0.95
      Digestible glycine 0.37 0.38 0.37
      Digestible cystine 0.26 0.30 0.30
      Digestible valine 0.77 0.79 0.78
      Digestible tyrosine 0.46 0.50 0.52

      Table 2. 

      Measured values of effective energy and digestible essential amino acid contents of experimental diets from 0 to 21 d (%).

    • Geneb Sequences of primers (5'-3')c Serial No.
      Claudin-1 F: CATACTCCTGGGTCTGGTTGGT NM_001013611.2
      R: GACAGCCATCCGCATCTTCT
      β-actin F: CAACACAGTGCTGTCTGGTGGTAC NM_205518.1
      R: CTCCTGCTTGCTGATCCACATCTG
      Occludin F: ACGGCAGCACCTACCTCAA NM_205128.1
      R: GGGCGAAGAAGCAGATGAG
      ZO-1 F: CTTCAGGTGTTTCTCTTCCTCCTC XM_015278981.1
      R: CTGTGGTTTCATGGCTGGATC
      MUC 2 F: TTCATGATGCCTGCTCTTGTG XM_421035
      R: CCTGAGCCTTGGTACATTCTTGT
      IL-1β F: ACTGGGCATCAAGGGCTA NM_204524.1
      R: GGTAGAAGATGAAGCGGGTC
      IL-6 F: CGCCCAGAAATCCCTCCTC XM_015281283.1
      R: AGGCACTGAAACTCCTGGTC
      IL-8 F: ATGAACGGCAAGCTTGGAGCTG XM_015301388.1
      R: TCCAAGCACACCTCTCTTCCATCC
      IL-10 F: GCTGCCAAGCCCTGTT NM_001004414.2
      R: CCTCAAACTTCACCCTCA
      IL-18 F: TGATGAGCTGGAATGCGATG NM_204608.3
      R: ACTGCCAGATTTCACCTCCTG
      TNF-α F: GAGCGTTGACTTGGCTGTC XM_204267
      R: AAGCAACAACCAGCTATGCAC
      MyD88 F: TGCAAGACCATGAAGAACGA NM_001030962.5
      R: TCACGGCAGCAAGAGAGATT
      NF-κB F: GTG TGA AGA AAC GGG AAC TG NM_205129.1
      R: GGC ACG GTT GTC ATA GAT GG
      TLR-4 F: CCACTATTCGGTTGGTGGAC NM_001030693.1
      R: ACAGCTTCTCAGCAGGCAAT
      a Primers were designed using Primer Express software (Sangon Biotech Co., LTD., Shanghai, China). b Zonula occludens-1 (ZO-1); mucin2 (MUC 2); interleukin-1β (IL-1β); interleukin-6 (IL-6); interleukin-8 (IL-8); interleukin-10 (IL-10); interleukin-18 (IL-18); tumor necrosis factor α (TNF-α); myeloid differentiation factor 88 (MyD88); nuclear factor kappa B (NF-κB); toll-like receptor-4 (TLR-4). c F for forward; R for reverse.

      Table 3. 

      Sequences of oligonucleotide primersa for real-time quantitative fluorescence PCR.

    • SBM content Mannanase Day 0 to 21 Day 22 to 42 Day 0 to 42
      BW (kg) ADG (kg) ADFI (kg) FCR BW (kg) ADG (kg) ADFI (kg) FCR ADG, kg ADFI, kg FCR
      Control group 0 mg/kg 0.832bc 0.037b 0.054 1.427bc 2.690 0.088 0.151 1.711 0.063 0.102 1.569
      100 mg/kg 0.877a 0.040a 0.055 1.375d 2.852 0.094 0.153 1.631 0.067 0.104 1.503
      50% of SBM of control 0 mg/kg 0.822cd 0.037b 0.054 1.450b 2.625 0.086 0.154 1.797 0.061 0.104 1.623
      100 mg/kg 0.862ab 0.039a 0.055 1.412c 2.678 0.087 0.153 1.765 0.063 0.104 1.589
      25% of SBM of control 0 mg/kg 0.804cd 0.036b 0.054 1.493a 2.475 0.080 0.149 1.879 0.058 0.102 1.686
      100 mg/kg 0.798d 0.036b 0.054 1.496a 2.427 0.077 0.143 1.848 0.057 0.098 1.672
      SEM 0.006 0.000 0.000 0.008 0.029 0.001 0.001 0.015 0.001 0.007 0.010
      Main effect
      Mannanase 0 mg/kg 0.819 0.037b 0.054 1.457a 2.597 0.085 0.151 1.795a 0.061 0.103 1.626a
      100 mg/kg 0.846 0.038a 0.054 1.428b 2.652 0.095 0.150 1.748b 0.062 0.102 1.588b
      SBM content control group 0.855 0.039a 0.054 1.401c 2.771a 0.091a 0.152a 1.671c 0.065a 0.103a 1.536c
      50% of SBM of control 0.842 0.038a 0.054 1.431b 2.652b 0.086b 0.153a 1.781b 0.062b 0.104a 1.606b
      25% of SBM of control 0.801 0.036b 0.054 1.494a 2.451c 0.078c 0.146b 1.863a 0.057c 0.100b 1.679a
      p-value
      Mannanase 0.003 0.004 0.269 0.003 0.211 0.469 0.422 0.022 0.154 0.658 < 0.001
      SBM content < 0.001 < 0.001 0.762 < 0.001 < 0.001 < 0.001 0.036 < 0.001 < 0.001 0.041 < 0.001
      Mannanase × SBM 0.036 0.069 0.526 0.055 0.161 0.267 0.339 0.515 0.140 0.292 0.120
      a, b, c The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

      Table 4. 

      Effect of mannanase addition to diets with different SBM content on growth performance of broilers.

    • SBM content Mannanase VO2 (L) VCO2(L) RQ Nint (g/d) Nexc (g/d) TRN (g/d)
      35.66% SBM 0 mg/kg 35.407 36.399 1.028a 3.470 1.413 2.057b
      100 mg/kg 34.152 34.300 1.011bc 3.640 1.094 2.546a
      17.83% SBM 0 mg/kg 32.990 33.632 1.020ab 3.494 1.634 1.861b
      100 mg/kg 32.771 32.432 1.003c 3.521 1.530 1.992b
      8.92% SBM 0 mg/kg 36.165 36.354 1.006bc 3.462 1.573 1.889b
      100 mg/kg 31.563 32.075 1.013abc 3.532 1.576 1.957b
      SEM 0.510 0.516 0.002 0.019 0.045 0.053
      Main effect
      Mannanase 0 mg/kg 34.854a 35.462a 1.018 3.476b 1.540a 1.936b
      100 mg/kg 32.829b 32.936b 1.009 3.565a 1.400b 2.165a
      SBM content 35.66% SBM 34.780 35.350 1.020 3.555 1.256b 2.302a
      17.83% SBM 32.880 33.032 1.012 3.508 1.582a 1.926b
      8.92% SBM 33.864 34.215 1.010 3.497 1.574a 1.923b
      p-value
      Mannanase 0.039 0.010 0.043 0.012 0.061 0.005
      SBM content 0.270 0.141 0.147 0.328 0.001 < 0.001
      Mannanase × SBM 0.154 0.388 0.037 0.213 0.196 0.068
      a, b, c The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

      Table 5. 

      Effect of mannanase addition to diets with different SBM content on the respiratory metabolism and N balance of broilers at 21 d.

    • SBM content Mannanase THP (KJ) HI (KJ) RE (KJ) REpro (KJ) REfat (KJ) AME
      (MJ/kg)      		 AMEn
      (MJ/kg)      		 NE
      (MJ/kg)      		 NE :
      AME      		 AME : ADG
      (KJ/g)      		 NE : ADG
      (KJ/g)
      35.66% SBM 0 mg/kg 755.609 318.010 553.430 306.545b 246.884 12.307 11.641 9.330 0.758 12.667 9.607
      100 mg/kg 724.772 267.340 647.049 379.367a 267.682 12.527 11.803 10.153 0.812 12.602 10.213
      17.83% SBM 0 mg/kg 702.607 262.826 608.921 277.277b 331.644 12.323 11.723 9.841 0.798 12.690 10.130
      100 mg/kg 693.039 249.293 634.557 296.747b 337.811 12.454 11.811 10.116 0.812 12.633 10.261
      8.92% SBM 0 mg/kg 767.646 333.854 553.408 281.412b 271.996 12.438 11.827 9.294 0.748 12.977 9.696
      100 mg/kg 671.706 263.332 649.486 291.569b 357.916 12.485 11.849 9.993 0.800 13.094 10.478
      SEM 10.776 10.552 15.626 7.846 13.337 0.077 0.071 0.109 0.008 0.084 0.107
      Main effect
      Mannanase 0 mg/kg 741.954a 304.897a 571.920b 288.412b 283.508 12.356 11.730 9.488b 0.768b 12.778 9.811b
      100 mg/kg 696.506b 259.988b 643.697a 322.561a 321.136 12.489 11.821 10.087a 0.808a 12.776 10.317a
      SBM content 35.66% SBM 740.191 292.675 600.240 342.956a 257.283b 12.417 11.722 9.741 0.785 12.635 9.910
      17.83% SBM 697.823 256.060 621.739 287.012b 334.728a 12.389 11.767 9.978 0.805 12.662 10.195
      8.92% SBM 719.676 298.593 601.447 286.491b 314.956ab 12.462 11.838 9.643 0.774 13.035 10.087
      p-value
      Mannanase 0.028 0.030 0.025 0.005 0.135 0.426 0.551 0.005 0.006 0.993 0.017
      SBM content 0.230 0.178 0.810 < 0.001 0.040 0.935 0.820 0.377 0.189 0.111 0.508
      Mannanase × SBM 0.193 0.494 0.566 0.068 0.379 0.911 0.931 0.503 0.431 0.883 0.398
      a, b The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

      Table 6. 

      Effect of mannanase addition to diets with different SBM content on energy metabolism in broilers at 21 d.

    • SBM content Mannanase ATTD
      of DM      		 ATTD
      of CP      		 ATTD
      of GE
      35.66% SBM 0 mg/kg 67.062 59.355b 72.360
      100 mg/kg 69.497 71.307a 73.988
      17.83% SBM 0 mg/kg 68.646 53.074b 74.507
      100 mg/kg 69.777 56.517b 76.043
      8.92% SBM 0 mg/kg 69.744 54.575b 76.982
      100 mg/kg 70.157 55.347b 75.970
      SEM 0.541 1.417 0.560
      Main effect
      Mannanase 0 mg/kg 68.484 55.668b 74.616
      100 mg/kg 69.810 61.057a 75.334
      SBM content 35.66% SBM 68.280 65.331a 73.174b
      17.83% SBM 69.211 54.795b 75.275ab
      8.92% SBM 69.950 54.961b 76.476a
      p-value
      Mannanase 0.239 0.015 0.508
      SBM content 0.474 < 0.001 0.053
      Mannanase × SBM 0.752 0.093 0.527
      a, b The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

      Table 7. 

      Effect of mannanase addition to diets with different SBM content on the ATTD of DM, CP, and GE of broilers at 21 d (%).

    • SBM content Mannanase Threonine Lysine Tryptophan Methionine Arginine Leucine Valine Isoleucine Phenylalanine
      35.66% SBM 0 mg/kg 0.830 0.894 0.852 0.935 0.937 0.890 0.829 0.851 0.897
      100 mg/kg 0.838 0.907 0.845 0.942 0.943 0.899 0.860 0.876 0.914
      17.83% SBM 0 mg/kg 0.817 0.872 0.877 0.929 0.934 0.872 0.815 0.826 0.884
      100 mg/kg 0.830 0.881 0.905 0.934 0.934 0.879 0.826 0.834 0.891
      8.92% SBM 0 mg/kg 0.836 0.870 0.872 0.928 0.932 0.883 0.828 0.832 0.898
      100 mg/kg 0.840 0.886 0.903 0.931 0.933 0.897 0.836 0.847 0.904
      SEM 0.004 0.003 0.008 0.002 0.002 0.003 0.004 0.005 0.003
      Main effect
      Mannanase 0 mg/kg 0.828 0.879b 0.867 0.931 0.934 0.882b 0.824b 0.836b 0.893b
      100 mg/kg 0.836 0.892a 0.884 0.936 0.937 0.891a 0.840a 0.852a 0.903a
      SBM content 35.66% SBM 0.834 0.901a 0.848b 0.939 0.940 0.894a 0.845a 0.864a 0.905a
      17.83% SBM 0.824 0.877b 0.891a 0.931 0.934 0.876b 0.820b 0.830b 0.888b
      8.92% SBM 0.838 0.881b 0.888a 0.929 0.933 0.890a 0.832ab 0.840b 0.901a
      p-value
      Mannanase 0.299 0.005 0.222 0.170 0.488 0.079 0.039 0.037 0.072
      SBM content 0.310 < 0.001 0.034 0.101 0.300 0.019 0.047 0.003 0.031
      Mannanase × SBM 0.879 0.789 0.475 0.918 0.813 0.850 0.444 0.612 0.668
      SBM content Mannanase Histidine Glycine Aspartic acid Glutamic acid Cystine Alanine Serine Proline Tyrosine
      35.66% SBM 0 mg/kg 0.875 0.484 0.832 0.896 0.757 0.831 0.836 0.844 0.858
      100 mg/kg 0.892 0.549 0.861 0.907 0.781 0.862 0.861 0.866 0.892
      17.83% SBM 0 mg/kg 0.846 0.483 0.823 0.894 0.768 0.828 0.828 0.832 0.874
      100 mg/kg 0.860 0.497 0.832 0.900 0.790 0.842 0.837 0.842 0.872
      8.92% SBM 0 mg/kg 0.853 0.502 0.832 0.904 0.780 0.856 0.845 0.851 0.871
      100 mg/kg 0.852 0.543 0.835 0.908 0.802 0.867 0.851 0.857 0.890
      SEM 0.005 0.012 0.005 0.003 0.006 0.004 0.004 0.004 0.004
      Main effect
      Mannanase 0 mg/kg 0.858 0.490b 0.829 0.898 0.768b 0.839b 0.836b 0.842b 0.867b
      100 mg/kg 0.868 0.530a 0.843 0.905 0.791a 0.857a 0.850a 0.855a 0.885a
      SBM content 35.66% SBM 0.884a 0.516 0.846 0.902 0.769 0.847ab 0.849 0.855 0.875
      17.83% SBM 0.853b 0.490 0.827 0.897 0.779 0.835b 0.832 0.837 0.873
      8.92% SBM 0.853b 0.523 0.833 0.906 0.791 0.862a 0.848 0.854 0.880
      p-value
      Mannanase 0.243 0.096 0.119 0.203 0.062 0.015 0.083 0.089 0.020
      SBM content 0.005 0.470 0.202 0.450 0.329 0.019 0.154 0.106 0.665
      Mannanase × SBM 0.612 0.665 0.444 0.865 0.998 0.450 0.522 0.631 0.124
      a, b The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

      Table 8. 

      Effect of mannanase addition to diets with different SBM content on the ATTD of AA of broilers at 21 d (%).

    • SBM content Mannanase 21 d 42 d
      Control group 0 mg/kg 1.083 1.120a
      100 mg/kg 1.059 1.079b
      50% of SBM of control 0 mg/kg 1.070 1.113a
      100 mg/kg 1.033 1.096ab
      25% of SBM of control 0 mg/kg 1.048 1.096ab
      100 mg/kg 1.046 1.124a
      SEM 0.004 0.005
      Main effect
      Mannanase 0 mg/kg 1.067a 1.110
      100 mg/kg 1.046b 1.110
      SBM content Control group 1.071a 1.099
      50% of SBM of control 1.051b 1.104
      25% of SBM of control 1.047b 1.110
      p-value
      Mannanase 0.004 0.251
      SBM content 0.015 0.604
      Mannanase × SBM 0.108 0.008
      a, b The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

      Table 9. 

      Effect of mannanase addition to diets with different SBM content on jejunal chyme viscosity in broilers (P).

    • SBM content Mannanase DAO (ng/mL) D-LA (nmol/L) ET (EU/ml)
      35.66% SBM 0 mg/kg 24.711 73.848a 0.219
      100 mg/kg 24.171 68.059c 0.188
      17.83% SBM 0 mg/kg 25.079 68.146c 0.152
      100 mg/kg 22.858 63.183d 0.135
      8.92% SBM 0 mg/kg 24.433 69.186bc 0.170
      100 mg/kg 23.430 72.881ab 0.151
      SEM 0.295 0.785 0.007
      Main effect
      Mannanase 0 mg/kg 24.741a 70.393 0.180a
      100 mg/kg 23.486b 68.041 0.158b
      SBM content 35.66% SBM 24.441 70.953 0.204a
      17.83% SBM 23.969 65.664 0.160b
      8.92% SBM 23.932 71.034 0.143b
      p-value
      Mannanase 0.036 0.069 0.048
      SBM content 0.728 0.001 < 0.001
      Mannanase × SBM 0.480 0.006 0.850
      a, b, c, d The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

      Table 10. 

      Effect of mannanase addition to diets with different SBM content on intestinal barrier integrity of broilers at 21 d.

    • SBM content Mannanase VH (μm) CD (μm) V:C
      35.66% SBM 0 mg/kg 656.073b 111.063a 5.441c
      100 mg/kg 729.529a 109.180ab 6.695a
      17.83% SBM 0 mg/kg 664.777b 113.061a 5.879b
      100 mg/kg 712.769a 108.930ab 6.492a
      8.92% SBM 0 mg/kg 666.053b 100.126c 6.005b
      100 mg/kg 679.013b 104.606bc 6.546a
      SEM 5.584 0.889 0.079
      Main effect
      Mannanase 0 mg/kg 662.301 108.084 5.775
      100 mg/kg 707.103 107.572 6.578
      SBM content 35.66% SBM 692.801 110.122 6.068
      17.83% SBM 688.773 110.996 6.185
      8.92% SBM 672.533 102.366 6.276
      p-value
      Mannanase < 0.001 0.703 < 0.001
      SBM content 0.124 < 0.001 0.220
      Mannanase × SBM 0.018 0.032 0.007
      a, b, c The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

      Table 11. 

      Effect of mannanase addition to diets with different SBM content on morphological indexes of ileal epithelium in broilers at 21 d.

    • SBM content Mannanase ZO-1 Occludin Claudin-1 MUC-2
      35.66% SBM 0 mg/kg 1.000 1.000 1.000 1.000
      100 mg/kg 1.070 1.579 1.081 1.118
      17.83% SBM 0 mg/kg 0.884 1.143 0.748 0.933
      100 mg/kg 0.916 1.321 1.539 1.049
      8.92% SBM 0 mg/kg 0.660 1.500 0.641 1.004
      100 mg/kg 1.111 1.770 1.330 0.968
      SEM 0.060 0.125 0.082 0.052
      Main effect
      Mannanase 0 mg/kg 0.848 1.215 0.796b 0.979
      100 mg/kg 1.032 1.556 1.316a 1.045
      SBM content 35.66% SBM 1.035 1.289 1.040 1.059
      17.83% SBM 0.900 1.232 1.143 0.991
      8.92% SBM 0.886 1.635 0.985 0.986
      p-value
      Mannanase 0.127 0.183 0.001 0.550
      SBM content 0.529 0.378 0.667 0.831
      Mannanase × SBM 0.289 0.794 0.109 0.805
      a, b The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

      Table 12. 

      Effect of mannanase addition to diets with different SBM content on the relative expression of genes associated with the jejunal barrier in broilers at 21 d.

    • SBM content Mannanase ZO-1 Occludin Claudin-1 MUC-2
      35.66% SBM 0 mg/kg 1.000 1.000 1.000 1.000
      100 mg/kg 1.363 1.336 1.332 1.227
      17.83% SBM 0 mg/kg 0.922 0.793 0.912 0.978
      100 mg/kg 0.935 0.925 1.094 1.177
      8.92% SBM 0 mg/kg 0.701 0.733 1.020 1.226
      100 mg/kg 1.254 1.135 1.865 1.004
      SEM 0.083 0.067 0.111 0.081
      Main effect
      Mannanase 0 mg/kg 0.875b 0.842b 0.977b 1.068
      100 mg/kg 1.184a 1.132a 1.430a 1.136
      SBM content 35.66% SBM 1.182 1.168 1.166 1.113
      17.83% SBM 0.928 0.859 1.003 1.077
      8.92% SBM 0.978 0.934 1.442 1.115
      p-value
      Mannanase 0.062 0.029 0.040 0.691
      SBM content 0.405 0.133 0.247 0.979
      Mannanase × SBM 0.392 0.672 0.420 0.481
      a, b The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

      Table 13. 

      Effect of mannanase addition to diets with different SBM content on the relative expression of genes associated with the ileal barrier in broilers at 21 d.

    • SBM content Mannanase IL-1β IL-6 IL-8 IL-10 IL-18 TNF-a MyD88 NF-kB TLR-4
      35.66% SBM 0 mg/kg 1.000a 1.000 1.000 1.000 1.000a 1.000 1.000 1.000a 1.000
      100 mg/kg 0.546b 0.302 0.658 1.274 0.547b 0.829 0.754 0.612bc 0.751
      17.83% SBM 0 mg/kg 0.434b 0.709 0.385 0.617 0.414bc 0.867 0.685 0.575bc 0.612
      100 mg/kg 0.436b 0.345 0.269 0.843 0.226c 0.809 0.520 0.330c 0.555
      8.92% SBM 0 mg/kg 0.434b 0.734 0.337 0.690 0.295bc 0.912 0.941 0.541bc 0.885
      100 mg/kg 0.768ab 0.647 0.426 1.141 0.579b 0.700 0.556 0.679b 0.575
      SEM 0.052 0.076 0.055 0.088 0.054 0.062 0.053 0.051 0.048
      Main effect
      mannanase 0 mg/kg 0.623 0.815a 0.574 0.769b 0.570 0.926 0.876a 0.705a 0.832a
      100 mg/kg 0.583 0.431b 0.451 1.086a 0.451 0.779 0.610b 0.540b 0.627b
      SBM content 35.66% SBM 0.773 0.651 0.829a 1.137 0.774 0.914 0.877a 0.806a 0.876a
      17.83% SBM 0.435 0.527 0.327b 0.730 0.320 0.838 0.603b 0.453b 0.584b
      8.92% SBM 0.601 0.691 0.382b 0.915 0.437 0.806 0.749ab 0.610ab 0.730ab
      p-value
      Mannanase 0.650 0.010 0.173 0.071 0.159 0.258 0.009 0.068 0.023
      SBM content 0.011 0.626 < 0.001 0.164 < 0.001 0.779 0.078 0.008 0.031
      Mannanase × SBM 0.003 0.229 0.150 0.852 0.003 0.879 0.646 0.052 0.470
      a, b, c The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

      Table 14. 

      Effect of mannanase addition to diets with different SBM content on the relative expression of inflammatory response genes in the ileum of broilers at 21 d.