Impact of mannanase on broiler performance, intestinal health, and energy utilization with varying soybean meal levels

Xiaodan Zhang; Bin Wang; Zhibin Ban; Mi Wang; Yuan Wang; Xinzhi Wang; Yuming Guo; Xiaodan Zhang; Bin Wang; Zhibin Ban; Mi Wang; Yuan Wang; Xinzhi Wang; Yuming Guo

doi:10.48130/animadv-0025-0009

Mannanase specifically degrades mannan, increases the efficiency of energy utilization, and improves intestinal health in broilers. The interaction effects between mannanase and soybean meal (SBM) have not been extensively explored. Therefore, the present study aimed to determine effects of adding mannanase to diets with different SBM content on broilers, and to explore interaction effects between mannanase and SBM. This study was conducted on Arbor Acres broilers. Under low-energy conditions (metabolizable energy reduced by 50 kcal/kg), a 3 × 2 factorial design was used with three SBM content diets (control group, 50%, or 25% of the SBM content of control) and with two levels of mannanase (0 or 100 mg/kg) respectively. In experiment 1, growth performance and intestinal health were determined. Experiment 2 measured energy metabolism in broilers by respiratory calorimetry, while feces were collected to determine nutrient digestibility. Results indicated that low SBM diets supplemented with degossypolled cottonseed protein and corn gluten meal significantly reduced broiler growth performance during d 0−42. However, mannanase supplementation in diets containing 35.66% and 17.83% SBM significantly improved growth performance from d 0 to 21, reduced respiratory quotient at 21 d, and improved intestinal health (p < 0.05). In the 35.66% SBM diet, mannanase also enhanced energy metabolism by improving nitrogen retention and protein energy utilization (p < 0.05). However, mannanase showed limited efficacy when SBM content was reduced to 8.92%. Microbiological analyses showed that mannanase significantly reduced Escherichia coli and promoted 2-Oxocarboxylic acid metabolism in cecal microbes. In conclusion, there was a reciprocal relationship between mannanase and SBM content, with mannanase still exerting the above beneficial effects at the SBM level of 17.83%.

HTML

Introduction

Soybean meal (SBM) is the main source of vegetable protein (VP) in poultry feed, containing about 17%−27% non-starch polysaccharides (NSP)^[1], which limits its nutritional value^[2]. NSP is a common anti-nutritional factor (ANF) in poultry feed that stimulates the animal’s innate immune system and leads to energy loss^[3]. Hemicellulose, the second most abundant polymer in nature, is usually found in plant cell walls alongside lignin and cellulose^[4]. Mannan, as a major component of hemicellulose in legumes, is relatively the most important type of ANF in SBM. It is a polysaccharide composed of mannose units linked by β-1,4-bonds^[5]. NSP in SBM mainly exists as glucomannan and galactomannan^[6]. It has been shown that mannan can increase the viscosity of chyme^[7,8], induce feed-induced immune response (FIIR), cause energy loss^[9], disrupt microbial community structure^[10], and affect animal growth performance^[11].

Mannanase is widely found in animals, plants, and microorganisms^[12]. It can act specifically upon the β-1,4-D-mannosidic bond within mannans^[13,14]. Mannanase has strict substrate specificity, allowing it to produce mannooligosaccharides (MOS) while degrading mannan, thus maximizing its energy potential^[3]. Studies have shown that mannanase can lower the viscosity of intestinal chyme^[15], promote the digestion and absorption of feed nutrients^[16,17], and improve the nutritional value of SBM^[18]. Additionally, mannanase can regulate intestinal flora structure^[19,20], maintain the integrity of intestinal epithelium^[21,22], enhance immune function^[6,23], reduce the energy loss from FIIR^[24], increase the efficiency of energy utilization^[25,26], and improve the growth performance of poultry^[27−29]. Poultry do not have the enzymes required to break down mannan. Thus, the exogenous supply of mannanase has increasingly emerged as an effective strategy to improve growth performance.

Studies have indicated that adding mannanase to low-energy diet increases N-corrected apparent metabolizable energy (AMEn)^[24], and improves the growth performance of broilers^[30]. The role played by mannanase depends mainly on the type of substrate and the amount of mannan in the diet^[31]. In summary, many studies have confirmed that mannanase specifically degrades mannan, increases energy utilization efficiency, and improves intestinal health in broilers. However, there has been limited research on the interaction between mannanase and SBM. In addition, previous findings have shown that a 50 kcal/kg reduction in dietary energy levels can lead to reduced growth performance and impaired intestinal health in broilers. The addition of mannanase can improve broilers’ growth performance by alleviating intestinal inflammatory response, regulating bacterial flora structure, and increasing the efficiency of feed nutrient utilization^[32]. Therefore, the aim of this study was to determine the effects of mannanase supplementation in diets with different SBM content on the growth performance, intestinal health, and effective energy value of broilers under the condition that the metabolizable energy (ME) level of the diets was reduced by 50 kcal/kg, and the effects of the interaction between mannanase and SBM content was also preliminarily explored and revealed.

Materials and methods

Experimental animals and diets

This study was conducted on Arbor Acres (AA+) broilers and the feed formulation was designed following the nutritional demands of broilers as suggested by NY/T33-2004. Corn-SBM diet was formulated under low-energy conditions, reducing the ME by 50 kcal/kg. Diets were formulated with degossypolled cottonseed protein (DCP), and corn gluten meal (CGM) instead of SBM while ensuring that the energy and crude protein (CP) levels were consistent across treatment groups. The feeding management and nutritional supply of the birds were in accordance with the guidelines and regulations presented in the Feeding Management Manual.

Experimental design

This study was randomized into six treatments using a 3 × 2 factorial design. Under low-energy conditions (ME reduced by 50 kcal/kg), broilers were fed diets containing different levels of SBM (0−21 d: 35.66%, 17.83%, and 8.92%; 22−42 d: 30.58%, 15.29%, and 7.65%) with two levels of mannanase (0 or 100 mg/kg). The composition and nutrient levels of the test diets are presented in Table 1, while Table 2 shows the measured values for each treatment group. All the diets were provided in pellet form.

Table 1. Composition and proportions of experimental diets^a (%, as is basis).

Item	Day 0 to 21			Day 22 to 42
Item	35.66% SBM group	17.83% SBM group	8.92% SBM group	30.58% SBM group	15.29% SBM group	7.65% SBM group
Composition ratio (%)
Corn (7.8% CP)	54.00	59.82	59.91	58.17	62.78	65.73
SBM (44% CP)	35.66	17.83	8.92	30.58	15.29	7.65
DCP		10.00	12.00		9.65	13.18
CGM	3.24	6.00	10.44	3.17	5.15	7.11
Soybean oil	2.76	1.15	1.02	4.46	3.20	2.25
L-lysine hydrochloride (98.5%)	0.12	0.45	0.60	0.16	0.37	0.50
Calcium hydrogen phosphate	1.84	1.96	2.10	1.51	1.55	1.53
Stone powder	1.25	1.36	1.34	1.26	1.32	1.37
NaCl	0.39	0.39	0.43	0.24	0.24	0.25
Trace mineral feed^b	0.20	0.20	0.20	0.10	0.10	0.10
Choline chloride (50%)	0.20	0.20	0.20	0.10	0.10	0.10
DL-Methionine (99%)	0.21	0.22	0.17	0.14	0.13	0.11
L-Tryproan		0.10	0.12
L-Threonine		0.20	0.21
Antioxidants	0.05	0.05	0.05	0.05	0.05	0.05
Vitamin premix^c	0.03	0.03	0.03	0.02	0.03	0.03
Phytase	0.02	0.02	0.02	0.02	0.02	0.02
Zeolite	0.02	0.02	2.24	0.02	0.02	0.02
Calculated nutrient levels
ME, Mcal/kg	2.95	2.95	2.95	3.10	3.10	3.10
CP	22.13	22.13	22.12	20.19	20.19	20.19
Ca	1.01	1.05	1.05	0.92	0.93	0.93
Available phosphorus	0.45	0.47	0.49	0.39	0.40	0.40
Lysine	1.20	1.25	1.22	1.10	1.11	1.12
Methionine	0.56	0.59	0.56	0.46	0.47	0.47
Tryproan	0.18	0.25	0.24
Threonine	0.72	0.86	0.85
^a The feed was in granular form. ^b The analytical values for each kg of trace mineral feed ingredients were presented as follows: Cu 8 g; Fe 40 g; Zn 55 g; Mn 60 g; I 750 mg; Se 150 mg; Co 250 mg; moisture ≤ 10%. ^c The analytical values for each kg of vitamin premix composition were presented as follows: vitamin A 50 million IU; vitamin D₃ 12 million IU; vitamin E 100,000 IU; vitamin K₃ 10 g; vitamin B₁ 8 g; vitamin B₂ 32 g; vitamin B₆ 12 g; vitamin B₁₂ 100 mg; nicotinamide 150 g; D-pantothenic acid 46 g; folic acid 5 g; biotin 500 mg; moisture ≤ 6%.

Table 2. Measured values of effective energy and digestible essential amino acid contents of experimental diets from 0 to 21 d (%).

Items	35.66% SBM	17.83% SBM	8.92% SBM
ME (Mcal/kg)	2.94	2.94	2.97
NE (Mcal/kg)	2.23	2.35	2.22
Digestible lysine	1.20	1.18	1.17
Digestible methionine	0.50	0.55	0.53
Digestible threonine	0.77	0.82	0.84
Digestible tryptophan	0.17	0.25	0.24
Digestible arginine	1.32	1.37	1.30
Digestible leucine	1.76	1.71	1.78
Digestible isoleucine	0.69	0.64	0.61
Digestible histidine	0.42	0.45	0.43
Digestible phenylalanine	0.91	0.92	0.95
Digestible glycine	0.37	0.38	0.37
Digestible cystine	0.26	0.30	0.30
Digestible valine	0.77	0.79	0.78
Digestible tyrosine	0.46	0.50	0.52

The broiler chickens were randomly divided into each treatment group. In experiment 1, 576 1-day-old AA+ broilers were selected, with eight replicates of 12 chickens per treatment for 42 d. The trial was conducted in two rearing phases at the Zhuozhou Teaching Experimental Farm of China Agricultural University (Hebei, China). In experiment 2, 180 AA+ broilers aged 17 d were selected, with six replicates of five chickens per treatment, and the testing period lasted from 17 to 24 d of age. This trial was completed in three phases, with two replicates as one phase of 7 d each. All experimental broilers were reared in the experimental chicken house of the Animal Husbandry Science Branch of the Jilin Academy of Agricultural Sciences (Jilin, China).

Respiration chambers

In experiment 2, an open-circuit indirect calorimetry respiration chamber designed for poultry was used to assess the impacts of adding mannanase to diets with different SBM levels on nutrient digestibility, nitrogen (N) balance, and energy metabolism in broilers. This equipment was developed by the Institute of Animal Nutrition and Feed Research of Jilin Academy of Agricultural Sciences, and the overall equipment consists of multi-channel gas analysis, multi-channel data acquisition system, respiratory metabolism chamber, multi-gas path driven by vortex fan, and heating and cooling equipment. Wherein the sensor for determining the oxygen (O₂) concentration is a zirconia sensor (Model 65-4-20, The Advanced Micro Instruments, USA), and the sensor for determining carbon dioxide (CO₂) concentration is an infrared sensor (AGM10, Sensors Europe GmbH, Germany). Additionally, the data acquisition system can provide real-time displays of test data and the operating status of the equipment. The remote control software can automatically calculate O₂ consumption, CO₂ production, and respiratory quotient (RQ) of broilers, and record the temperature and humidity data inside and outside the respiratory chamber, which can be viewed on the control interface of computerized data acquisition. The equipment was tested for functionality and air-tightness before the experiment.

Measurement of growth performance
On d 21 and 42, feed intake (FI) and body weight (BW) were measured for each replicate of each group in experiment 1. Average daily feed intake (ADFI), average daily gain (ADG), and feed conversion rate (FCR) were respectively computed for the periods of 0−21, 22−42, and 0−42 d.

Respiratory calorimetry

On d 20, two healthy broilers were randomly chosen from each replicate of each treatment group in experiment 2 and placed in the metabolic chamber of the respiratory calorimetry device. Broilers were acclimatized for 1 d and then measured for 3 d. The BW of the test chickens at 21 d and 42 d were recorded respectively, and the relevant indexes were calculated according to the following formula:

$ \mathrm{\rm{G}ross\; energy\; intake\; (GEI)\; =\ The\; gross\; energy\; (GE)\; of\; feed\, \times\, EI} $

$ \mathrm{\rm{G}ross\; excretory\; energy\; (GEE)\; =\; Fecal\; energy\; (FE)\, \times\, Fecal\; output} $

$ \rm Apparent\;metabolizable\;energy\;intake\;(AMEI)\;=\;GEI\,-\,GEE $

$ \rm Apparent\;metabolizable\;energy\;(AME)\;=\;\dfrac{AMEI}{FI} $

$\rm AMEn\;=\;\dfrac{AMEI\;-\;N\;deposition\;(RN)\;\times\;34.39}{FI}$

$ \mathrm{\rm{N}et\; energy\; (NE)\; =\; \dfrac{AMEI\; -\; Heat\; increment\; (HI)}{FI}} $

where, RN is the amount of N (kg) deposited by broilers per 1 kg of feed consumed and 34.39 is the correction factor.

$\begin{split} \quad\rm Heat\;production\;(HP)\;=\;& \rm 16.18\;\times\;O_2\;consumption\;(VO_2)\;+\;5.02\;\\&\rm\times\;CO_2\;excretion\;(VCO_2) \end{split}$

$ \mathrm{\rm{F}asting\; heat\; production\; (FHP)=Metabolic\; weight\; (BW^{0.70})\; \times\; 450} $

$ \mathrm{\mathrm{R}\mathrm{Q}=\dfrac{\mathrm{V}\mathrm{C}\mathrm{O}_2}{\mathrm{V}\mathrm{O}_2}} $

$\mathrm{H}\mathrm{I}=\mathrm{H}\mathrm{P}-\mathrm{F}\mathrm{H}\mathrm{P} $

$ \rm Energy\ deposition\ (RE)=AMEI\ -\ HP $

$ \mathrm{N}\; \mathrm{ }\mathrm{d}\mathrm{e}\mathrm{p}\mathrm{o}\mathrm{s}\mathrm{i}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n}\mathrm{ }\; \left(\mathrm{T}\mathrm{R}\mathrm{N}\right)=\mathrm{I}\mathrm{n}\mathrm{g}\mathrm{e}\mathrm{s}\mathrm{t}\mathrm{e}\mathrm{d}\; \mathrm{ }\mathrm{N}\; \mathrm{ }\; \left(\mathrm{N}_{\mathrm{i}\mathrm{n}\mathrm{t}}\right)\; -\; \mathrm{E}\mathrm{x}\mathrm{c}\mathrm{r}\mathrm{e}\mathrm{t}\mathrm{e}\mathrm{d}\; \mathrm{ }\mathrm{N}\; \mathrm{ }\left(\mathrm{N}_{\mathrm{e}\mathrm{x}\mathrm{c}}\right) $

$ \mathrm{P}\mathrm{r}\mathrm{o}\mathrm{t}\mathrm{e}\mathrm{i}\mathrm{n}\;\mathrm{d}\mathrm{e}\mathrm{p}\mathrm{o}\mathrm{s}\mathrm{i}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n}\;\mathrm{e}\mathrm{n}\mathrm{e}\mathrm{r}\mathrm{g}\mathrm{y}\;({\mathrm{R}\mathrm{E}}_{\mathrm{p}\mathrm{r}\mathrm{o}})=\mathrm{T}\mathrm{R}\mathrm{N}\,\times\, 6.25\,\times \,23.84 $

$ \mathrm{F}\mathrm{a}\mathrm{t}\;\mathrm{d}\mathrm{e}\mathrm{p}\mathrm{o}\mathrm{s}\mathrm{i}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n}\;\mathrm{e}\mathrm{n}\mathrm{e}\mathrm{r}\mathrm{g}\mathrm{y}\;\left({\mathrm{R}\mathrm{E}}_{\mathrm{f}\mathrm{a}\mathrm{t}}\right)=\mathrm{R}\mathrm{E}-{\mathrm{R}\mathrm{E}}_{\mathrm{p}\mathrm{r}\mathrm{o}} $

where, 6.25 is the conversion coefficient of protein to N and 23.8 is the energy contained in 1 kg of protein (MJ).

Measurement of nutrient digestibility

In experiment 2, excreta were collected concurrently with the respiratory calorimetry, and the apparent total tract digestibility (ATTD) of nutrients was determined using the Total Collection Method. At 21 to 24 d, two broilers were randomly chosen from each replicate of each treatment group for collecting fecal samples. The initial weight of the mixed fecal sample was recorded, and then it was dried in an oven at 65 °C for 72 h until a constant weight was achieved. The dried sample was allowed to cool at room temperature for 24 h, weighed again, and crushed. Dry matter (DM), CP, GE, and amino acid (AA) in diets and feces were determined. DM, CP, and GE were detected by GB/T 6435-2014, GB/T 6432-1994, and ISO 9831:1998, respectively. AA was determined according to GB/T 18246-2019. The ME content in the feed was calculated according to the formula: ME of feed (MJ/kg) = GE of feed × ATTD of GE.

The ATTD was calculated using the following formula:

$ \begin{split} & \mathrm{T}\mathrm{h}\mathrm{e}\; \mathrm{A}\mathrm{T}\mathrm{T}\mathrm{D}\; \mathrm{o}\mathrm{f}\; \mathrm{n}\mathrm{u}\mathrm{t}\mathrm{r}\mathrm{i}\mathrm{e}\mathrm{n}\mathrm{t}\mathrm{s}\mathrm{ }\; (\text{%})= \\ &\quad\dfrac{\mathrm{N}\mathrm{u}\mathrm{t}\mathrm{r}\mathrm{i}\mathrm{e}\mathrm{n}\mathrm{t}\; \mathrm{c}\mathrm{o}\mathrm{n}\mathrm{t}\mathrm{e}\mathrm{n}\mathrm{t}\; \mathrm{o}\mathrm{f}\; \mathrm{i}\mathrm{n}\mathrm{g}\mathrm{e}\mathrm{s}\mathrm{t}\mathrm{e}\mathrm{d}\; \mathrm{f}\mathrm{e}\mathrm{e}\mathrm{d}-\mathrm{N}\mathrm{u}\mathrm{t}\mathrm{r}\mathrm{i}\mathrm{e}\mathrm{n}\mathrm{t}\; \mathrm{c}\mathrm{o}\mathrm{n}\mathrm{t}\mathrm{e}\mathrm{n}\mathrm{t}\; \mathrm{o}\mathrm{f}\; \mathrm{f}\mathrm{e}\mathrm{c}\mathrm{e}\mathrm{s}}{\mathrm{N}\mathrm{u}\mathrm{t}\mathrm{r}\mathrm{i}\mathrm{e}\mathrm{n}\mathrm{t}\; \mathrm{c}\mathrm{o}\mathrm{n}\mathrm{t}\mathrm{e}\mathrm{n}\mathrm{t}\; \mathrm{o}\mathrm{f}\; \mathrm{i}\mathrm{n}\mathrm{g}\mathrm{e}\mathrm{s}\mathrm{t}\mathrm{e}\mathrm{d}\; \mathrm{f}\mathrm{e}\mathrm{e}\mathrm{d}} \end{split} $

Sample collection

On d 21 and 42, a healthy broiler was randomly chosen from each replicate in experiment 1, weighed, and blood was collected. The molecular and tissue samples were collected from the jejunum and ileum after the execution of broilers. The intestinal chyme was carefully rinsed with normal saline. The molecular samples were promptly flash-frozen in liquid nitrogen, while the tissue samples intended for morphological analysis were fixed in a 4% paraformaldehyde solution. Additionally, samples of ileal and cecal chyme were collected and rapidly flash-frozen in liquid nitrogen for further study.

Measurement of jejunal chyme viscosity
An Ostwald viscosimeter (1831-2; 0.55 mm; Huanguang Glass Instruments Co., Ltd., Taizhou, Zhejiang, China) was used to determine the chyme viscosity^[32].

Measurement of intestinal barrier integrity
This test was performed using chicken diamine oxidase (DAO) and D-lactic acid (D-LA) ELISA kits produced by Shanghai Guduo Biotechnology Co., LTD. (Shanghai, China) to measure DAO and D-LA contents in serum. A chicken endotoxin (ET) test LAL kit provided by Xiamen Bioendo Technology Co., Ltd. (Xiamen, China) was used to evaluate ET levels in serum.

Measurement of intestinal morphology
After paraffin embedding and fixation of ileal tissues, sections were prepared. The intestinal tissues were stained with HE. Then, these stained tissues were observed using a Leica microscope (Wetzlar, Germany, ModelDMi8) to determine the morphology of the intestinal epithelium^[32].

Measurement of gene expression related to intestinal immunity and intestinal barrier

Total RNA from the jejunum and ileum was extracted using TRIzol reagent. The concentration of total RNA was measured with a NanoDrop 2000 microspectrophotometer. In accordance with the instructions included with each kit, reverse transcription and fluorescence quantification were carried out separately. Using β-actin as an internal reference gene, the expression levels of genes related to intestinal immunity and intestinal barrier were measured by an ABI 7500 real-time fluorescence quantitative PCR instrument. Table 3 lists the primers that were employed for real-time fluorescent quantitative PCR in this trial. The relative expression of the mRNA of each target gene was calculated using the 2^−ΔΔCᴛ method.

Table 3. Sequences of oligonucleotide primers^a for real-time quantitative fluorescence PCR.

Gene^b	Sequences of primers (5'-3')^c	Serial No.
Claudin-1	F: CATACTCCTGGGTCTGGTTGGT	NM_001013611.2
Claudin-1	R: GACAGCCATCCGCATCTTCT	NM_001013611.2
β-actin	F: CAACACAGTGCTGTCTGGTGGTAC	NM_205518.1
β-actin	R: CTCCTGCTTGCTGATCCACATCTG	NM_205518.1
Occludin	F: ACGGCAGCACCTACCTCAA	NM_205128.1
Occludin	R: GGGCGAAGAAGCAGATGAG	NM_205128.1
ZO-1	F: CTTCAGGTGTTTCTCTTCCTCCTC	XM_015278981.1
ZO-1	R: CTGTGGTTTCATGGCTGGATC	XM_015278981.1
MUC 2	F: TTCATGATGCCTGCTCTTGTG	XM_421035
MUC 2	R: CCTGAGCCTTGGTACATTCTTGT	XM_421035
IL-1β	F: ACTGGGCATCAAGGGCTA	NM_204524.1
IL-1β	R: GGTAGAAGATGAAGCGGGTC	NM_204524.1
IL-6	F: CGCCCAGAAATCCCTCCTC	XM_015281283.1
IL-6	R: AGGCACTGAAACTCCTGGTC	XM_015281283.1
IL-8	F: ATGAACGGCAAGCTTGGAGCTG	XM_015301388.1
IL-8	R: TCCAAGCACACCTCTCTTCCATCC	XM_015301388.1
IL-10	F: GCTGCCAAGCCCTGTT	NM_001004414.2
IL-10	R: CCTCAAACTTCACCCTCA	NM_001004414.2
IL-18	F: TGATGAGCTGGAATGCGATG	NM_204608.3
IL-18	R: ACTGCCAGATTTCACCTCCTG	NM_204608.3
TNF-α	F: GAGCGTTGACTTGGCTGTC	XM_204267
TNF-α	R: AAGCAACAACCAGCTATGCAC	XM_204267
MyD88	F: TGCAAGACCATGAAGAACGA	NM_001030962.5
MyD88	R: TCACGGCAGCAAGAGAGATT	NM_001030962.5
NF-κB	F: GTG TGA AGA AAC GGG AAC TG	NM_205129.1
NF-κB	R: GGC ACG GTT GTC ATA GAT GG	NM_205129.1
TLR-4	F: CCACTATTCGGTTGGTGGAC	NM_001030693.1
TLR-4	R: ACAGCTTCTCAGCAGGCAAT	NM_001030693.1
^a Primers were designed using Primer Express software (Sangon Biotech Co., LTD., Shanghai, China). ^b Zonula occludens-1 (ZO-1); mucin2 (MUC 2); interleukin-1β (IL-1β); interleukin-6 (IL-6); interleukin-8 (IL-8); interleukin-10 (IL-10); interleukin-18 (IL-18); tumor necrosis factor α (TNF-α); myeloid differentiation factor 88 (MyD88); nuclear factor kappa B (NF-κB); toll-like receptor-4 (TLR-4). ^c F for forward; R for reverse.

16S rRNA sequencing of microorganisms in the ileum and cecum

DNA isolation and high-throughput sequencing operations

To further investigate the effect of mannanase addition to diets containing 17.83% SBM on intestinal microorganisms of broilers at 21 d, 16S rRNA gene sequencing was conducted on chyme samples from both the 17.83% SBM group and the mannanase addition group in experiment 1. DNA of microorganisms was extracted from the contents of the ileum and cecum. The extraction and concentration of DNA were determined. After the amplification of the bacterial DNA, the PCR products were purified. Then the library was constructed and quantified^[32]. After the library met the required standards, HiSeq2500-PE250 was used for the sequencing process. The sequencing analysis was carried out by Shenzhen Weike Meng Technology Group Co., Ltd.

Processing of the sequences and analyses in bioinformatics
Effective tags were clustered to obtain amplicon sequencing variants (ASVs) using Divisive Amplicon Denoising Algorithm 2 (DADA 2). The sequenced samples were bipartite sequenced using the Illumina NovaSeq platform, and the obtained sequencing data were split by barcode to obtain valid sequence information. The entire raw sequences of all samples were filtered using the DADA 2 plugin of QIIME2 software, followed by denoising and merging, with chimeras removed to form operational taxonomic units (OTUs). Based on the principles of algorithmic design, the representative sequence was annotated with species. The Greengenes Database 13_8 database was used for species annotation analysis and based on the species annotation information, OTUs, and their contained sequences were checked. Based on the absolute abundance and the annotation information of OTUs, the number of sequences per sample at seven taxonomic levels were counted as a proportion of the total number of sequences to effectively assess the resolution of species annotation of samples. UniFrac distances of samples were calculated using QIIME software to construct the Unweighted Pair-Group Method with Arithmetic mean (UPGMA) clustering trees. Based on the Latent Dirichlet Allocation (LDA), Linear discriminant analysis Effect Size (LEfSe) was used to identify the biomarkers that showed statistically significant differences among different groups (bacterial categories with significant differences in relative abundance). R software (Version 2.15.3) was used to make Venn diagrams, coverage index plots, PCA and PCoA plots, along with Analysis of similarities (ANOSIM). T-tests and Kruskal Wallis tests between each group were performed using R software for microorganisms with relative abundance > 0.001. Finally, PICRUSt2 was utilized to predict and conduct an analysis of the function of the metagenome.

Statistical analyses
In this study, the data from each group in the two experiments were statistically analyzed by SPSS Statistics V22.0. A general linear model (univariate analysis) was employed for statistical analysis, and differences between treatments were analyzed by Duncan’s multiple comparison test. All differences that were considered statistically significant were determined based on a p value < 0.05. Additionally, p values between 0.05 and 0.1 were categorized as trends.

Discussion

As the first line of host defense against pathogens, Toll-like receptors (TLRs) can recognize different pathogen-associated molecular patterns (PAMPs) and play key roles in inflammation and the regulation of immune cells. TLRs trigger a complex inflammatory response through both MyD88-dependent and MyD88-independent pathways, activating NF-κB, and promoting the expression of genes such as TNF-a, IL-1β, and IL-6^[33]. During the onset of the inflammatory response, the activation of the TLR/NF-κB and JAK/STAT signaling pathways promotes the release of a variety of pro-inflammatory factors and stimulates immune cells to release additional cytokines^[34]. Pro-inflammatory cytokines like IL-1β and TNF-a are particularly potent, inducing the production of many pro-inflammatory mediators and playing an important role in the development of the immune system^[35−39]. IL-8 is a multifunctional cytokine that stimulates the proliferation of immune cells and is involved in inflammatory diseases^[40]. In this study, when ME was reduced by 50 kcal/kg, the diet with 35.66% SBM content triggered an inflammatory response in broilers. In contrast, the addition of mannanase significantly reduced the relative expression of IL-1β and IL-18 in the ileum of broilers at 21 d, and it also tended to reduce the relative expression of NF-κB, alleviating the above adverse effects. In addition, the reduction of SBM content to 17.83% significantly reduced the relative expression of NF-κB, TLR-4, and IL-8, with a tendency to lower the relative expression of MyD88, compared with the 35.66% SBM group. As a surface component of several pathogens, mannan is the relatively most important ANF in SBM, which stimulates the immune system, triggers an inflammatory response, and causes energy depletion^[9,41−43]. Studies have shown that there is a reciprocal effect between mannanase and SBM content^[44], showing that adding mannanase to diets reduces the incidence of inflammatory reactions^[3], decreases immune stimulation^[24], and improves the immune system of broilers^[6]. The results mentioned above are in accordance with our findings and further suggest that mannanase alleviates the inflammatory response in broiler chickens by lowering the expression of the NF-κB and lessening the release of pro-inflammatory factors.

Activation of multiple inflammatory pathways and release of inflammatory mediators can affect intestinal barrier function, which will have an impact on the growth performance and intestinal health of broilers^[45]. An intact intestinal barrier is mainly composed of a physical barrier, a biochemical barrier, and an immune barrier^[46], of which tight junctions (TJs), as an important component of the intestinal barrier, are the determining factors affecting the intestinal barrier function of animals^[47,48]. Occludin, claudin-1, and zonula occluden-1 (ZO-1) are the relatively most prominent TJs^[49]. As a major component of mucins, MUC 2 is mainly produced by goblet cells. MUC 2 is an important component of the intestinal mucosal layer and plays an important role in separating the intestinal epithelium from microorganisms^[50,51]. Mannanase has been shown to regulate intestinal barrier integrity by affecting the expression of TJs and other proteins in the broiler intestine^[3]. In this experiment, adding mannanase significantly increased the relative expression of Claudin-1 in the jejunum at 21 d, significantly increased the relative expression of occludin and Claudin-1 in the ileum, and also had a tendency to increase the relative expression of ZO-1 in the ileum.

When the integrity of the intestinal barrier is impaired, pathogenic microorganisms and toxins can pass through the intestinal epithelium, which may cause a systemic inflammatory response^[52−54]. Serum DAO^[55], D-LA, and ET^[56] are important indicators for evaluating mucosal integrity and intestinal barrier function in broilers. In this study, reducing the ME by 50 kcal/kg in a diet containing 35.66% SBM led to increased levels of D-LA in serum and disruption of intestinal epithelial barrier in broilers at 21 d. Mannanase alleviated the increased intestinal permeability due to lower energy levels and maintained the intestinal barrier function by reducing the levels of DAO and ET. In addition, there was a reciprocal effect between mannanase and SBM content. The diets were formulated with DCP and CGM instead of SBM. When SBM content in the diet was reduced to 17.83%, adding mannanase still tended to reduce serum D-LA in broilers at 21 d. The reduction of serum DAO, D-LA, and ET levels in broilers further demonstrated that mannanase could improve intestinal barrier function and maintain barrier integrity.

There is a close relationship between intestinal morphology and immune regulation. The function of the intestinal barrier and absorption function can be visualized by the microscopic structure of intestinal morphology^[57]. The intestinal VH, CD, and V:C are important for measuring the morphological and structural integrity, as well as the functional status of the intestinal mucosa. Mannanase improves intestinal epithelial morphology in broilers by increasing intestinal VH and V:C^[21], and decreasing CD^[58]. Consistent with our findings, the diet containing 35.66% SBM significantly reduced ileal VH and V:C and disrupted the villus structure in broilers at 21 d when dietary ME was reduced by 50 kcal/kg. In addition, there was an interaction between mannanase and SBM content on the morphology of ileum epithelium at 21 d. When SBM content was reduced to 17.83%, mannanase still improved ileal morphology and alleviated intestinal damage in broilers by increasing the VH and V:C.

The immune system interacts with intestinal microorganisms to maintain homeostasis of the host’s internal environment and regulate intestinal health^[59−62]. Gut microbiota composition is an important indicator for evaluating gut health, playing a key role in maintaining gut integrity, energy metabolism, and immune function^[63,64]. The diversity of the intestinal flora maintains the stability of the internal environment against the invasion of pathogenic microorganisms^[65]. In this study, there was no significant effect of mannanase on the gut microbiota diversity of broilers at 21 d. It has been shown that mannanase can regulate intestinal flora structure by promoting the multiplication of beneficial bacteria like Lactobacilli^[21], reducing the number of intestinal Escherichia coli^[7,66], and Salmonella^[67,68]. At the same time, it also can enhance barrier functions and ultimately improve the intestinal health of broilers. Ruminococcus is an anaerobic Gram-positive bacterium related to the class Clostridia^[69], which degrades polysaccharides, provides nutrients for the host^[70], and is strongly implicated in the development of several diseases^[71−73]. Escherichia coli is a gram-negative bacterium that can act as a pathogen causing intestinal diseases^[74,75]. In this study, in terms of relative abundance of microorganisms, adding mannanase to the diet with 17.85% SBM content tended to decrease the relative abundance of Firmicutes and increase Ruminococcus in the ileum of broilers at 21 d. In addition, mannanase also significantly reduced Lachnospiraceae_Clostridium and Escherichia coli in the cecum of broilers at 21 d. In summary, when SBM content was 17.83%, adding mannanase improved intestinal health by regulating the intestinal flora structure.

A reciprocal relationship between mannanase and substrate type on the viscosity of chyme has been reported. Adding mannanase to poultry feed reduces intestinal chyme viscosity, while higher levels of mannan in diets lead to increased chyme viscosity^[15,18]. In the present study, we observed that the addition of mannanase to the diets highly significantly decreased the viscosity of the jejunal chyme in broilers at 21 d, and the chyme viscosity decreased with the decrease in SBM content. Specifically, compared to the 35.66% SBM group, when the SBM content was reduced to 17.83% and 8.92%, the chyme viscosity of broilers at 21 d was also significantly reduced. In addition, there was a reciprocal effect between mannanase and SBM content on the chyme viscosity of the jejunum at 42 d. The effect of mannanase was significant when the SBM content was 35.66%. The addition of mannanase to poultry feed has been reported to promote nutrient absorption, increase nutrient digestibility^[8,11,24,31], and improve the nutritive value of soybean meal-based diets^[17]. Consistent with our results, adding mannanase to the low-energy diet significantly increased the ATTD of CP and AA such as Lys, Ile, and Ala in broilers at 21 d.

Energy is an important component of poultry feed and plays a central role in poultry nutrition. Compared to ME, NE expresses energy loss in the form of calories which provides a more accurate assessment of energy utilization by broilers^[76]. Studies have shown that adding mannanase to diets improves energy utilization efficiency^[7,18] by increasing AMEn^[10] and decreasing N_exc^[24,77]. However, studies by respiratory calorimetry to determine the effect of mannanase on N balance and energy metabolism in broilers have not been reported. In this study, we found that adding mannanase to the diets affected N balance by decreasing VO₂ and VCO₂ and increasing TRN in broiler chickens at 21 d. There was a reciprocal effect of mannanase and SBM content on TRN in broilers at 21 d. In addition, we also observed that mannanase supplementation significantly reduced HP and HI in broilers at 21 d, and increased the NE value of feed and NE:AME. There was a significant reciprocal effect of mannanase and SBM content on the RE_pro in broilers at 21 d. When SBM content was reduced to 17.83%, it significantly reduced the RE_pro and increased RE_fat in broilers at 21 d, affecting energy metabolism.

The reduction in feed energy levels and the changes in SBM content affect the growth performance of poultry^[41]. Mannanase may ameliorate the decline in the growth performance of broilers due to energy deficiency by reducing FCR and increasing BW and ADG^[41], and these results are consistent with our findings. Additionally, it has been shown that there is a reciprocal effect between mannanase and the type of substrate on the growth performance of broilers^[66,78] and that the action of mannanase is mainly dependent on the type of substrate and the amount of NSP contained in the feed^[79]. In this study, we observed that a 50 kcal/kg reduction in ME led to decreased growth performance in broilers as SBM content was lowered. However, the addition of mannanase mitigated the above harmful effects by increasing BW and ADG of broilers at 21 d and decreasing FCR. Moreover, there was a significant reciprocal effect of mannanase and SBM content on the growth performance of broilers from 0 to 21 d of age. When the SBM content was reduced to 17.83%, the addition of mannanase still significantly improved growth performance of broilers from 0 to 21 d of age. The improved growth performance of broilers in this study also provides further evidence that mannanase can mitigate the negative effects due to lower levels of energy and the mannan content of SBM by improving intestinal barrier function and flora structure. Our findings demonstrate that mannanase supplementation enhances broiler growth performance and intestinal health, particularly in diets containing 35.66% and 17.83% SBM.

[1]	Vangroenweghe F, Poulsen K, Thas O. 2021. Supplementation of a β-mannanase enzyme reduces post-weaning diarrhea and antibiotic use in piglets on an alternative diet with additional soybean meal. Porcine Health Management 7:8 doi: 10.1186/s40813-021-00191-5 CrossRef Google Scholar
[2]	Meng X, Slominski BA. 2005. Nutritive values of corn, soybean meal, canola meal, and peas for broiler chickens as affected by a multicarbohydrase preparation of cell wall degrading enzymes. Poultry Sciencei 84(8):1242−51 doi: 10.1093/ps/84.8.1242 CrossRef Google Scholar
[3]	Arsenault RJ, Lee JT, Latham R, Carter B, Kogut MH. 2017. Changes in immune and metabolic gut response in broilers fed β-mannanase in β-mannan-containing diets. Poultry Science 96(12):4307−16 doi: 10.3382/ps/pex246 CrossRef Google Scholar
[4]	Dawood A, Ma K. 2020. Applications of microbial β-mannanases. Frontiers in Bioengineering and Biotechnology 8:598630 doi: 10.3389/fbioe.2020.598630 CrossRef Google Scholar
[5]	Li YN, Meng K, Wang YR, Yao B. 2006. A β-mannanase from Bacillus subtilis B36: purification, properties, sequencing, gene cloning and expression in Escherichia coli. Zeitschrift für Naturforschung C 61(11−12):840−46 doi: 10.1515/znc-2006-11-1212 CrossRef Google Scholar
[6]	Zou XT, Qiao XJ, Xu ZR. 2006. Effect of β-mannanase (Hemicell) on growth performance and immunity of broilers. Poultry Science 12(85):2176−79 doi: 10.1093/ps/85.12.2176 CrossRef Google Scholar
[7]	Sornlake W, Matetaviparee P, Rattanaphan N, Tanapongpipat S, Eurwilaichitr L. 2013. β-Mannanase production by Aspergillus niger BCC4525 and its efficacy on broiler performance. Journal of the Science of Food and Agriculture 93(13):3345−51 doi: 10.1002/jsfa.6183 CrossRef Google Scholar
[8]	Caldas JV, Vignale K, Boonsinchai N, Wang J, Putsakum M, et al. 2018. The effect of β-mannanase on nutrient utilization and blood parameters in chicks fed diets containing soybean meal and guar gum. Poultry Science 7(98):2807−17 doi: 10.3382/ps/pey099 CrossRef Google Scholar
[9]	Hsiao H Y, Anderson D M, Dale N M. 2006. Levels of β-mannan in soybean meal. Poultry Science 85(8):1430−32 doi: 10.1093/ps/85.8.1430 CrossRef Google Scholar
[10]	Kim MC, Kim JH, Pitargue FM, Koo DY, Choi HS, et al. 2017. Effect of dietary β-mannanase on productive performance, egg quality, and utilization of dietary energy and nutrients in aged laying hens raised under hot climatic conditions. Asian-Australasian Journal of Animal Sciences 30(10):1450−55 doi: 10.5713/ajas.17.0269 CrossRef Google Scholar
[11]	Balasubramanian B, Ingale SL, Park JH, Rathi PC, Shanmugam S, et al. 2018. Inclusion of dietary β-mannanase improves performance and ileal digestibility and reduces ileal digesta viscosity of broilers fed corn-soybean meal based diet. Poultry Science 97(9):3097−101 doi: 10.3382/ps/pey157 CrossRef Google Scholar
[12]	Yoon KH, Chung S, Lim BL. 2008. Characterization of the Bacillus subtilis WL-3 mannanase from a recombinant Escherichia coli. The Journal of Microbiology 46(3):344−49 doi: 10.1007/s12275-008-0045-y CrossRef Google Scholar
[13]	Zhao Y, Xue Y, Ma Y. 2009. Recent advances and prospect on structural biology of β-mannanase - a review. Acta Microbiologica Sinica 49(9):1131−37 (in Chinese) doi: 10.3321/j.issn:0001-6209.2009.09.001 CrossRef Google Scholar
[14]	Moreira LS, Filho EF. 2008. An overview of mannan structure and mannan-degrading enzyme systems. Applied Microbiology and Biotechnology 2(79):165−78 doi: 10.1007/s00253-008-1423-4 CrossRef Google Scholar
[15]	Lee JT, Bailey CA, Cartwright AL. 2003. β-Mannanase ameliorates viscosity-associated depression of growth in broiler chickens fed guar germ and hull fractions. Poultry Science 82(12):1925−31 doi: 10.1093/ps/82.12.1925 CrossRef Google Scholar
[16]	Ko H, Kang HK, Moturi J, Ingale SL, Kim J. 2021. Supplementation of enzyme cocktail in chickens diet is an effective approach to increase the utilization of nutrient in wheat-based diets. Journal of Animal Science and Technology 63(1):69−76 doi: 10.5187/jast.2021.e1 CrossRef Google Scholar
[17]	Dhawan S, Kaur J. 2007. Microbial mannanases: an overview of production and applications. Critical Reviews in Biotechnology 4(27):197−216 doi: 10.1080/07388550701775919 CrossRef Google Scholar
[18]	Latham RE, Williams MP, Walters HG, Carter B, Lee JT. 2018. Efficacy of β-mannanase on broiler growth performance and energy utilization in the presence of increasing dietary galactomannan. Poultry Science 2(97):549−56 doi: 10.3382/ps/pex309 CrossRef Google Scholar
[19]	Meng X, Slominski BA, Nyachoti CM, Campbell LD, Guenter W. 2005. Degradation of cell wall polysaccharides by combinations of carbohydrase enzymes and their effect on nutrient utilization and broiler chicken performance. Poultry Science 1(84):37−47 doi: 10.1093/ps/84.1.37 CrossRef Google Scholar
[20]	Bhaturiwala R, Bagban M, Singh TA, Modi HA. 2021. Partial purification and application of β-mannanase for the preparation of low molecular weight galacto and glucomannan. Biocatalysis and Agricultural Biotechnology 36:102155 doi: 10.1016/j.bcab.2021.102155 CrossRef Google Scholar
[21]	Lai LP, Lee MT, Chen CS, Yu B, Lee TT. 2015. Effects of co-fermented Pleurotus eryngii stalk residues and soybean hulls by Aureobasidium pullulans on performance and intestinal morphology in broiler chickens. Poultry Science 94(12):2959−69 doi: 10.3382/ps/pev302 CrossRef Google Scholar
[22]	Ayoola AA, Malheiros RD, Grimes JL, Ferket PR. 2015. Effect of dietary exogenous enzyme supplementation on enteric mucosal morphological development and adherent mucin thickness in Turkeys. Frontiers in Veterinary Science 45(2):13 doi: 10.3389/fvets.2015.00045 CrossRef Google Scholar
[23]	Mangi MH, Hussain T, Shahid MS, Sabir N, Kalhoro MS, et al. 2021. Effects of flaxseed and multi-carbohydrase enzymes on the cecal microbiota and liver inflammation of laying hens. Animals 11(3):600 doi: 10.3390/ani11030600 CrossRef Google Scholar
[24]	Ferreira HC Jr, Hannas MI, Albino LT, Rostagno HS, Neme R, et al. 2016. Effect of the addition of β-mannanase on the performance, metabolizable energy, amino acid digestibility coefficients, and immune functions of broilers fed different nutritional levels. Poultry Science 8(95):1848−57 doi: 10.3382/ps/pew076 CrossRef Google Scholar
[25]	Zheng L, Cho SH, Kang CW, Lee KW, Kim KE, et al. 2020. Effects of β-mannanase on egg production performance, egg quality, intestinal microbiota, viscosity, and ammonia concentration in laying hens. Brazilian Journal of Poultry Science 1(22):eRBCA-2019-1180 doi: 10.1590/1806-9061-2019-1180 CrossRef Google Scholar
[26]	Ibuki M, Yoshimoto Y, Inui M, Fukui K, Yonemoto H, et al. 2014. Dietary mannanase-hydrolyzed copra meal improves growth and increases muscle weights in growing broiler chickens. Animal Science Journal 85(5):562−68 doi: 10.1111/asj.12178 CrossRef Google Scholar
[27]	Aziz Ur Rahman M, Jamal U, Anwar U, Bilal MQ, Riaz M, et al. 2021. Effects of potato peels inclusion with exogenous enzymes in broiler diet on growth performance, nutrients digestibility and carcass characteristics. Science Progress 4(104):312032468 doi: 10.1177/00368504211061972 CrossRef Google Scholar
[28]	Saleh AA, Nahla A, Amber K, Badawi N, Aboelenin SM, et al. 2022. Effect of dietary incorporation of peanut and linseed meals with or without enzyme mixture on physiological performance of broilers. Saudi Journal of Biological Sciences 6(29):103291 doi: 10.1016/j.sjbs.2022.103291 CrossRef Google Scholar
[29]	Kiarie EG, Steelman S, Martinez, Livingston K. 2021. Significance of single β-mannanase supplementation on performance and energy utilization in broiler chickens, laying hens, turkeys, sows, and nursery-finish pigs: a meta-analysis and systematic review. Translational Animal Science 5(4):txab160 doi: 10.1093/tas/txab160 CrossRef Google Scholar
[30]	Williams MP, Brown B, Rao S, Lee JT. 2014. Evaluation of β-mannanase and nonstarch polysaccharide-degrading enzyme inclusion separately or intermittently in reduced energy diets fed to male broilers on performance parameters and carcass yield. Journal of Applied Poultry Research 4(23):715−23 doi: 10.3382/japr.2014-01008 CrossRef Google Scholar
[31]	Ryu MH, Hosseindoust A, Kim JS, Choi YH, Lee SH, et al. 2017. β-Mannanase derived from Bacillus subtilis WL-7 improves the performance of commercial laying hens fed low or high mannan-based diets. The Journal of Poultry Science 54(3):212−17 doi: 10.2141/jpsa.0160021 CrossRef Google Scholar
[32]	Zhang X, Xu H, Gong L, Wang J, Fu J, et al. 2024. Mannanase improves the growth performance of broilers by alleviating inflammation of the intestinal epithelium and improving intestinal microbiota. Animal Nutrition 16:376−94 doi: 10.1016/j.aninu.2023.06.017 CrossRef Google Scholar
[33]	Pasare C, Medzhitov R. 2004. Toll-like receptors: linking innate and adaptive immunity. Microbes and Infection 6(15):1382−87 doi: 10.1016/j.micinf.2004.08.018 CrossRef Google Scholar
[34]	Liu Q, Liang X, Liang M, Qin R, Qin F, et al. 2020. Ellagic acid ameliorates renal ischemic-reperfusion injury through NOX4/JAK/STAT signaling pathway. Inflammation 43(1):298−309 doi: 10.1007/s10753-019-01120-z CrossRef Google Scholar
[35]	Dinarello CA. 2009. Immunological and inflammatory functions of the interleukin-1 family. Annual Review of Immunology 27:519−50 doi: 10.1146/annurev.immunol.021908.132612 CrossRef Google Scholar
[36]	Dinarello CA. 2011. Interleukin-1 in the pathogenesis and treatment of inflammatory diseases. Blood 117(14):3720−32 doi: 10.1182/blood-2010-07-273417 CrossRef Google Scholar
[37]	Bazzoni F, Beutler B. 1996. The tumor necrosis factor ligand and receptor families. New England Journal of Medicine 334(26):1717−25 doi: 10.1056/NEJM199606273342607 CrossRef Google Scholar
[38]	Locksley RM, Killeen N, Lenardo MJ. 2001. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104(4):487−501 doi: 10.1016/s0092-8674(01)00237-9 CrossRef Google Scholar
[39]	Aggarwal BB. 2003. Signalling pathways of the TNF superfamily: a double-edged sword. Nature Reviews Immunology 3(9):745−56 doi: 10.1038/nri1184 CrossRef Google Scholar
[40]	Kany S, Vollrath J T, Relja B. 2019. Cytokines in Inflammatory Disease. International Journal of Molecular Sciences 20(23):6008 doi: 10.3390/ijms20236008 CrossRef Google Scholar
[41]	Wu G, Bryant MM, Voitle RA, Roland DA Sr. 2005. Effects of β-mannanase in corn-soy diets on commercial leghorns in second-cycle hens. Poultry Science 84(6):894−97 doi: 10.1093/ps/84.6.894 CrossRef Google Scholar
[42]	Li Y, Chen X, Chen Y, Li Z, Cao Y. 2010. Effects of β-mannanase expressed by Pichia pastoris in corn-soybean meal diets on broiler performance, nutrient digestibility, energy utilization and immunoglobulin levels. Animal Feed Science and Technology 159:59−67 doi: 10.1016/j.anifeedsci.2010.05.001 CrossRef Google Scholar
[43]	Rubartelli A, Lotze MT, Latz E, Manfredi A. 2013. Mechanisms of sterile inflammation. Frontiers in Immunology 22(4):398 doi: 10.3389/fimmu.2013.00398 CrossRef Google Scholar
[44]	Odetallah NH, Ferket PR, Grimes JL, McNaughton JL. 2002. Effect of mannan-endo-1,4-β-mannosidase on the growth performance of turkeys fed diets containing 44 and 48% crude protein soybean meal. Poultry Science 81(9):1322−31 doi: 10.1093/ps/81.9.1322 CrossRef Google Scholar
[45]	Tang Y, Zhang X, Wang Y, Guo Y, Zhu P, et al. 2022. Dietary ellagic acid ameliorated Clostridium perfringens-induced subclinical necrotic enteritis in broilers via regulating inflammation and cecal microbiota. Journal of Animal Science and Biotechnology 13(1):47 doi: 10.1186/s40104-022-00694-3 CrossRef Google Scholar
[46]	Salvo Romero E, Alonso Cotoner C, Pardo Camacho C, Casado Bedmar M, Vicario M. 2015. The intestinal barrier function and its involvement in digestive disease. Revista Espanola de Enfermedades Digestivas 107(11):686−96 doi: 10.17235/reed.2015.3846/2015 CrossRef Google Scholar
[47]	Nunes C, Freitas V, Almeida L, Laranjinha J. 2019. Red wine extract preserves tight junctions in intestinal epithelial cells under inflammatory conditions: implications for intestinal inflammation. Food & Function 10(3):1364−74 doi: 10.1039/c8fo02469c CrossRef Google Scholar
[48]	Parikh K, Antanaviciute A, Fawkner-Corbett D, Jagielowicz M, Aulicino A, et al. 2019. Colonic epithelial cell diversity in health and inflammatory bowel disease. Nature 567(7746):49−55 doi: 10.1038/s41586-019-0992-y CrossRef Google Scholar
[49]	Liao P, Liao M, Li L, Tan B, Yin Y. 2017. Effect of deoxynivalenol on apoptosis, barrier function, and expression levels of genes involved in nutrient transport, mitochondrial biogenesis and function in IPEC-J2 cells. Toxicology Research 6(6):866−77 doi: 10.1039/c7tx00202e CrossRef Google Scholar
[50]	Maloy KJ, Powrie F. 2011. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature 474(7351):298−306 doi: 10.1038/nature10208 CrossRef Google Scholar
[51]	Birchenough GH, Johansson MV, Gustafsson JK, Bergström JH, Hansson GC. 2015. New developments in goblet cell mucus secretion and function. Mucosal Immunology 8(4):712−19 doi: 10.1038/mi.2015.32 CrossRef Google Scholar
[52]	Ling KH, Wan MLY, El-Nezami H, Wang M. 2016. Protective capacity of resveratrol, a natural polyphenolic compound, against deoxynivalenol-induced intestinal barrier dysfunction and bacterial translocation. Chemical Research in Toxicology 29(5):823−33 doi: 10.1021/acs.chemrestox.6b00001 CrossRef Google Scholar
[53]	Slifer ZM, Blikslager AT. 2020. The integral role of tight junction proteins in the repair of injured intestinal epithelium. International Journal of Molecular Sciences 21(3):972 doi: 10.3390/ijms21030972 CrossRef Google Scholar
[54]	Xie SZ, Liu B, Ye HY, Li QM, Pan LH, et al. 2019. Dendrobium huoshanense polysaccharide regionally regulates intestinal mucosal barrier function and intestinal microbiota in mice. Carbohydrate Polymers 206:149−62 doi: 10.1016/j.carbpol.2018.11.002 CrossRef Google Scholar
[55]	Zhang B, Li G, Shahid MS, Gan L, Fan H, et al. 2020. Dietary ʟ-arginine supplementation ameliorates inflammatory response and alters gut microbiota composition in broiler chickens infected with Salmonella enterica serovar Typhimurium. Poultry Science 99(4):1862−74 doi: 10.1016/j.psj.2019.10.049 CrossRef Google Scholar
[56]	Xu J, Liu Z, Zhan W, Jiang R, Yang C, et al. 2018. Recombinant TsP53 modulates intestinal epithelial barrier integrity via upregulation of ZO-1 in LPS-induced septic mice. Molecular Medicine Reports 17(1):1212−18 doi: 10.3892/mmr.2017.7946 CrossRef Google Scholar
[57]	Madara JL, Nash S, Moore R, Atisook K. 1990. Structure and function of the intestinal epithelial barrier in health and disease. Monographs in Pathology 31:306−24 Google Scholar
[58]	Pantoja-Don Juan CA, Gómez-Verduzco G, Márquez-Mota CC, Téllez-Isaías G, Kwon YM, et al. 2022. Productive performance and cecum microbiota analysis of broiler chickens supplemented with β-mannanases and bacteriophages - a pilot study. Animals 12(2):169 doi: 10.3390/ani12020169 CrossRef Google Scholar
[59]	Gaggìa F, Mattarelli P, Biavati B. 2010. Probiotics and prebiotics in animal feeding for safe food production. International Journal of Food Microbiology 141(Suppl 1):S15−S28 doi: 10.1016/j.ijfoodmicro.2010.02.031 CrossRef Google Scholar
[60]	Wigley P. 2013. Immunity to bacterial infection in the chicken. Developmental and Comparative Immunology 41(3):413−17 doi: 10.1016/j.dci.2013.04.008 CrossRef Google Scholar
[61]	Hooper LV. 2009. Do symbiotic bacteria subvert host immunity? Nature Reviews Microbiology 7(5):367−74 doi: 10.1038/nrmicro2114 CrossRef Google Scholar
[62]	Belkaid Y, Harrison OJ. 2017. Homeostatic immunity and the microbiota. Immunity 46(4):562−76 doi: 10.1016/j.immuni.2017.04.008 CrossRef Google Scholar
[63]	Liu J, Wang HW, Lin L, Miao CY, Zhang Y, et al. 2019. Intestinal barrier damage involved in intestinal microflora changes in fluoride-induced mice. Chemosphere 234:409−18 doi: 10.1016/j.chemosphere.2019.06.080 CrossRef Google Scholar
[64]	Tang Q, Tang J, Ren X, Li C. 2020. Glyphosate exposure induces inflammatory responses in the small intestine and alters gut microbial composition in rats. Environmental Pollution 261:114129 doi: 10.1016/j.envpol.2020.114129 CrossRef Google Scholar
[65]	Yang WY, Lee Y, Lu H, Chou CH, Wang C. 2019. Analysis of gut microbiota and the effect of lauric acid against necrotic enteritis in Clostridium perfringens and Eimeria side-by-side challenge model. PLoS One 14(5):e0205784 doi: 10.1371/journal.pone.0205784 CrossRef Google Scholar
[66]	Mohammadigheisar M, Shouldice VL, Balasubramanian B, Kim IH. 2021. Effect of dietary supplementation of β-mannanase on growth performance, carcass characteristics, excreta microflora, blood constituents, and nutrient ileal digestibility in broiler chickens. Animal Bioscience 34(8):1342−49 doi: 10.5713/ab.20.0355 CrossRef Google Scholar
[67]	Gutierrez O, Zhang C, Caldwell DJ, Carey JB, Cartwright AL, et al. 2008. Guar meal diets as an alternative approach to inducing molt and improving Salmonella enteritidis resistance in late-phase laying hens. Poultry Science 87(3):536−40 doi: 10.3382/ps.2007-00337 CrossRef Google Scholar
[68]	Ibuki M, Fukui K, Yamauchi K. 2014. Effect of dietary mannanase-hydrolysed copra meal on growth performance and intestinal histology in broiler chickens. Journal of Animal Physiology and Animal Nutrition 98(4):636−42 doi: 10.1111/jpn.12105 CrossRef Google Scholar
[69]	Liu C, Finegold SM, Song Y, Lawson PA. 2008. Reclassification of Clostridium coccoides, Ruminococcus hansenii, Ruminococcus hydrogenotrophicus, Ruminococcus luti, Ruminococcus productus and Ruminococcus schinkii as Blautia coccoides gen. nov., comb. nov., Blautia hansenii comb. nov., Blautia hydrogenotrophica comb. nov., Blautia luti comb. nov., Blautia producta comb. nov., Blautia schinkii comb. nov. and description of Blautia wexlerae sp. nov. , isolated from human faeces. International Journal of Systematic and Evolutionary Microbiology 58(Pt 8):1896−902 doi: 10.1099/ijs.0.65208-0 CrossRef Google Scholar
[70]	La Reau AJ, Suen G. 2018. The Ruminococci: key symbionts of the gut ecosystem. Journal of Microbiology 56(3):199−208 doi: 10.1007/s12275-018-8024-4 CrossRef Google Scholar
[71]	Png CW, Lindén SK, Gilshenan KS, Zoetendal EG, McSweeney CS, et al. 2010. Mucolytic bacteria with increased prevalence in IBD mucosa augment in vitro utilization of mucin by other bacteria. The American Journal of Gastroenterology 105(11):2420−28 doi: 10.1038/ajg.2010.281 CrossRef Google Scholar
[72]	Peterson CT, Sharma V, Elmén L, Peterson SN. 2015. Immune homeostasis, dysbiosis and therapeutic modulation of the gut microbiota. Clinical & Experimental Immunology 179(3):363−77 doi: 10.1111/cei.12474 CrossRef Google Scholar
[73]	Zhou Y, Zhang M, Liu Q, Feng J. 2021. The alterations of tracheal microbiota and inflammation caused by different levels of ammonia exposure in broiler chickens. Poultry Science 100(2):685−96 doi: 10.1016/j.psj.2020.11.026 CrossRef Google Scholar
[74]	Jang J, Hur HG, Sadowsky MJ, et al. 2017. Environmental Escherichia coli: ecology and public health implications - a review. Journal of Applied Microbiology 123(3):570−81 doi: 10.1111/jam.13468 CrossRef Google Scholar
[75]	Kaper JB. 2005. Pathogenic Escherichia coli. International Journal of Medical Microbiology 295(6−7):355−56 doi: 10.1016/j.ijmm.2005.06.008 CrossRef Google Scholar
[76]	Barekatain MR, Noblet J, Wu SB, Iji PA, Choct M, et al. 2014. Effect of sorghum distillers dried grains with solubles and microbial enzymes on metabolizable and net energy values of broiler diets. Poultry Science 93(11):2793−801 doi: 10.3382/ps.2013-03766 CrossRef Google Scholar
[77]	Daskiran M, Teeter RG, Fodge D, Hsiao HY. 2004. An evaluation of endo-β-D-mannanase (Hemicell) effects on broiler performance and energy use in diets varying in β-mannan content. Poultry Science 83(4):662−68 doi: 10.1093/ps/83.4.662 CrossRef Google Scholar
[78]	Lee JT, Connor-Appleton S, Bailey CA, Cartwright AL. 2005. Effects of guar meal by-product with and without β-mannanase Hemicell on broiler performance. Poultry Science 84(8):1261−67 doi: 10.1093/ps/84.8.1261 CrossRef Google Scholar
[79]	Adeola O, Cowieson AJ. 2011. Opportunities and challenges in using exogenous enzymes to improve nonruminant animal production. Journal of Animal Science 89(10):3189−218 doi: 10.2527/jas.2010-3715 CrossRef Google Scholar

SBM content	Mannanase	Day 0 to 21				Day 22 to 42				Day 0 to 42
SBM content	Mannanase	BW (kg)	ADG (kg)	ADFI (kg)	FCR	BW (kg)	ADG (kg)	ADFI (kg)	FCR	ADG, kg	ADFI, kg	FCR
Control group	0 mg/kg	0.832^bc	0.037^b	0.054	1.427^bc	2.690	0.088	0.151	1.711	0.063	0.102	1.569
Control group	100 mg/kg	0.877^a	0.040^a	0.055	1.375^d	2.852	0.094	0.153	1.631	0.067	0.104	1.503
50% of SBM of control	0 mg/kg	0.822^cd	0.037^b	0.054	1.450^b	2.625	0.086	0.154	1.797	0.061	0.104	1.623
50% of SBM of control	100 mg/kg	0.862^ab	0.039^a	0.055	1.412^c	2.678	0.087	0.153	1.765	0.063	0.104	1.589
25% of SBM of control	0 mg/kg	0.804^cd	0.036^b	0.054	1.493^a	2.475	0.080	0.149	1.879	0.058	0.102	1.686
25% of SBM of control	100 mg/kg	0.798^d	0.036^b	0.054	1.496^a	2.427	0.077	0.143	1.848	0.057	0.098	1.672
SEM		0.006	0.000	0.000	0.008	0.029	0.001	0.001	0.015	0.001	0.007	0.010
Main effect
Mannanase	0 mg/kg	0.819	0.037^b	0.054	1.457^a	2.597	0.085	0.151	1.795^a	0.061	0.103	1.626^a
Mannanase	100 mg/kg	0.846	0.038^a	0.054	1.428^b	2.652	0.095	0.150	1.748^b	0.062	0.102	1.588^b
SBM content	control group	0.855	0.039^a	0.054	1.401^c	2.771^a	0.091^a	0.152^a	1.671^c	0.065^a	0.103^a	1.536^c
	50% of SBM of control	0.842	0.038^a	0.054	1.431^b	2.652^b	0.086^b	0.153^a	1.781^b	0.062^b	0.104^a	1.606^b
	25% of SBM of control	0.801	0.036^b	0.054	1.494^a	2.451^c	0.078^c	0.146^b	1.863^a	0.057^c	0.100^b	1.679^a
p-value
Mannanase		0.003	0.004	0.269	0.003	0.211	0.469	0.422	0.022	0.154	0.658	< 0.001
SBM content		< 0.001	< 0.001	0.762	< 0.001	< 0.001	< 0.001	0.036	< 0.001	< 0.001	0.041	< 0.001
Mannanase × SBM		0.036	0.069	0.526	0.055	0.161	0.267	0.339	0.515	0.140	0.292	0.120
^{a, b, c} The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

SBM content	Mannanase	VO₂ (L)	VCO₂(L)	RQ	N_int (g/d)	N_exc (g/d)	TRN (g/d)
35.66% SBM	0 mg/kg	35.407	36.399	1.028^a	3.470	1.413	2.057^b
35.66% SBM	100 mg/kg	34.152	34.300	1.011^bc	3.640	1.094	2.546^a
17.83% SBM	0 mg/kg	32.990	33.632	1.020^ab	3.494	1.634	1.861^b
17.83% SBM	100 mg/kg	32.771	32.432	1.003^c	3.521	1.530	1.992^b
8.92% SBM	0 mg/kg	36.165	36.354	1.006^bc	3.462	1.573	1.889^b
8.92% SBM	100 mg/kg	31.563	32.075	1.013^abc	3.532	1.576	1.957^b
SEM		0.510	0.516	0.002	0.019	0.045	0.053
Main effect
Mannanase	0 mg/kg	34.854^a	35.462^a	1.018	3.476^b	1.540^a	1.936^b
Mannanase	100 mg/kg	32.829^b	32.936^b	1.009	3.565^a	1.400^b	2.165^a
SBM content	35.66% SBM	34.780	35.350	1.020	3.555	1.256^b	2.302^a
	17.83% SBM	32.880	33.032	1.012	3.508	1.582^a	1.926^b
	8.92% SBM	33.864	34.215	1.010	3.497	1.574^a	1.923^b
p-value
Mannanase		0.039	0.010	0.043	0.012	0.061	0.005
SBM content		0.270	0.141	0.147	0.328	0.001	< 0.001
Mannanase × SBM		0.154	0.388	0.037	0.213	0.196	0.068
^{a, b, c} The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

SBM content	Mannanase	THP (KJ)	HI (KJ)	RE (KJ)	RE_pro (KJ)	RE_fat (KJ)	AME (MJ/kg)	AMEn (MJ/kg)	NE (MJ/kg)	NE : AME	AME : ADG (KJ/g)	NE : ADG (KJ/g)
35.66% SBM	0 mg/kg	755.609	318.010	553.430	306.545^b	246.884	12.307	11.641	9.330	0.758	12.667	9.607
35.66% SBM	100 mg/kg	724.772	267.340	647.049	379.367^a	267.682	12.527	11.803	10.153	0.812	12.602	10.213
17.83% SBM	0 mg/kg	702.607	262.826	608.921	277.277^b	331.644	12.323	11.723	9.841	0.798	12.690	10.130
17.83% SBM	100 mg/kg	693.039	249.293	634.557	296.747^b	337.811	12.454	11.811	10.116	0.812	12.633	10.261
8.92% SBM	0 mg/kg	767.646	333.854	553.408	281.412^b	271.996	12.438	11.827	9.294	0.748	12.977	9.696
8.92% SBM	100 mg/kg	671.706	263.332	649.486	291.569^b	357.916	12.485	11.849	9.993	0.800	13.094	10.478
SEM		10.776	10.552	15.626	7.846	13.337	0.077	0.071	0.109	0.008	0.084	0.107
Main effect
Mannanase	0 mg/kg	741.954^a	304.897^a	571.920^b	288.412^b	283.508	12.356	11.730	9.488^b	0.768^b	12.778	9.811^b
Mannanase	100 mg/kg	696.506^b	259.988^b	643.697^a	322.561^a	321.136	12.489	11.821	10.087^a	0.808^a	12.776	10.317^a
SBM content	35.66% SBM	740.191	292.675	600.240	342.956^a	257.283^b	12.417	11.722	9.741	0.785	12.635	9.910
	17.83% SBM	697.823	256.060	621.739	287.012^b	334.728^a	12.389	11.767	9.978	0.805	12.662	10.195
	8.92% SBM	719.676	298.593	601.447	286.491^b	314.956^ab	12.462	11.838	9.643	0.774	13.035	10.087
p-value
Mannanase		0.028	0.030	0.025	0.005	0.135	0.426	0.551	0.005	0.006	0.993	0.017
SBM content		0.230	0.178	0.810	< 0.001	0.040	0.935	0.820	0.377	0.189	0.111	0.508
Mannanase × SBM		0.193	0.494	0.566	0.068	0.379	0.911	0.931	0.503	0.431	0.883	0.398
^{a, b} The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

SBM content	Mannanase	ATTD of DM	ATTD of CP	ATTD of GE
35.66% SBM	0 mg/kg	67.062	59.355^b	72.360
35.66% SBM	100 mg/kg	69.497	71.307^a	73.988
17.83% SBM	0 mg/kg	68.646	53.074^b	74.507
17.83% SBM	100 mg/kg	69.777	56.517^b	76.043
8.92% SBM	0 mg/kg	69.744	54.575^b	76.982
8.92% SBM	100 mg/kg	70.157	55.347^b	75.970
SEM		0.541	1.417	0.560
Main effect
Mannanase	0 mg/kg	68.484	55.668^b	74.616
Mannanase	100 mg/kg	69.810	61.057^a	75.334
SBM content	35.66% SBM	68.280	65.331^a	73.174^b
	17.83% SBM	69.211	54.795^b	75.275^ab
	8.92% SBM	69.950	54.961^b	76.476^a
p-value
Mannanase		0.239	0.015	0.508
SBM content		0.474	< 0.001	0.053
Mannanase × SBM		0.752	0.093	0.527
^{a, b} The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

SBM content	Mannanase	21 d	42 d
Control group	0 mg/kg	1.083	1.120^a
Control group	100 mg/kg	1.059	1.079^b
50% of SBM of control	0 mg/kg	1.070	1.113^a
50% of SBM of control	100 mg/kg	1.033	1.096^ab
25% of SBM of control	0 mg/kg	1.048	1.096^ab
25% of SBM of control	100 mg/kg	1.046	1.124^a
SEM		0.004	0.005
Main effect
Mannanase	0 mg/kg	1.067^a	1.110
Mannanase	100 mg/kg	1.046^b	1.110
SBM content	Control group	1.071^a	1.099
	50% of SBM of control	1.051^b	1.104
	25% of SBM of control	1.047^b	1.110
p-value
Mannanase		0.004	0.251
SBM content		0.015	0.604
Mannanase × SBM		0.108	0.008
^{a, b} The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

SBM content	Mannanase	DAO (ng/mL)	D-LA (nmol/L)	ET (EU/ml)
35.66% SBM	0 mg/kg	24.711	73.848^a	0.219
35.66% SBM	100 mg/kg	24.171	68.059^c	0.188
17.83% SBM	0 mg/kg	25.079	68.146^c	0.152
17.83% SBM	100 mg/kg	22.858	63.183^d	0.135
8.92% SBM	0 mg/kg	24.433	69.186^bc	0.170
8.92% SBM	100 mg/kg	23.430	72.881^ab	0.151
SEM		0.295	0.785	0.007
Main effect
Mannanase	0 mg/kg	24.741^a	70.393	0.180^a
Mannanase	100 mg/kg	23.486^b	68.041	0.158^b
SBM content	35.66% SBM	24.441	70.953	0.204^a
	17.83% SBM	23.969	65.664	0.160^b
	8.92% SBM	23.932	71.034	0.143^b
p-value
Mannanase		0.036	0.069	0.048
SBM content		0.728	0.001	< 0.001
Mannanase × SBM		0.480	0.006	0.850
^{a, b, c, d} The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

SBM content	Mannanase	VH (μm)	CD (μm)	V:C
35.66% SBM	0 mg/kg	656.073^b	111.063^a	5.441^c
35.66% SBM	100 mg/kg	729.529^a	109.180^ab	6.695^a
17.83% SBM	0 mg/kg	664.777^b	113.061^a	5.879^b
17.83% SBM	100 mg/kg	712.769^a	108.930^ab	6.492^a
8.92% SBM	0 mg/kg	666.053^b	100.126^c	6.005^b
8.92% SBM	100 mg/kg	679.013^b	104.606^bc	6.546^a
SEM		5.584	0.889	0.079
Main effect
Mannanase	0 mg/kg	662.301	108.084	5.775
Mannanase	100 mg/kg	707.103	107.572	6.578
SBM content	35.66% SBM	692.801	110.122	6.068
	17.83% SBM	688.773	110.996	6.185
	8.92% SBM	672.533	102.366	6.276
p-value
Mannanase		< 0.001	0.703	< 0.001
SBM content		0.124	< 0.001	0.220
Mannanase × SBM		0.018	0.032	0.007
^{a, b, c} The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

SBM content	Mannanase	Threonine	Lysine	Tryptophan	Methionine	Arginine	Leucine	Valine	Isoleucine	Phenylalanine
35.66% SBM	0 mg/kg	0.830	0.894	0.852	0.935	0.937	0.890	0.829	0.851	0.897
35.66% SBM	100 mg/kg	0.838	0.907	0.845	0.942	0.943	0.899	0.860	0.876	0.914
17.83% SBM	0 mg/kg	0.817	0.872	0.877	0.929	0.934	0.872	0.815	0.826	0.884
17.83% SBM	100 mg/kg	0.830	0.881	0.905	0.934	0.934	0.879	0.826	0.834	0.891
8.92% SBM	0 mg/kg	0.836	0.870	0.872	0.928	0.932	0.883	0.828	0.832	0.898
8.92% SBM	100 mg/kg	0.840	0.886	0.903	0.931	0.933	0.897	0.836	0.847	0.904
SEM		0.004	0.003	0.008	0.002	0.002	0.003	0.004	0.005	0.003
Main effect
Mannanase	0 mg/kg	0.828	0.879^b	0.867	0.931	0.934	0.882^b	0.824^b	0.836^b	0.893^b
Mannanase	100 mg/kg	0.836	0.892^a	0.884	0.936	0.937	0.891^a	0.840^a	0.852^a	0.903^a
SBM content	35.66% SBM	0.834	0.901^a	0.848^b	0.939	0.940	0.894^a	0.845^a	0.864^a	0.905^a
	17.83% SBM	0.824	0.877^b	0.891^a	0.931	0.934	0.876^b	0.820^b	0.830^b	0.888^b
	8.92% SBM	0.838	0.881^b	0.888^a	0.929	0.933	0.890^a	0.832^ab	0.840^b	0.901^a
p-value
Mannanase		0.299	0.005	0.222	0.170	0.488	0.079	0.039	0.037	0.072
SBM content		0.310	< 0.001	0.034	0.101	0.300	0.019	0.047	0.003	0.031
Mannanase × SBM		0.879	0.789	0.475	0.918	0.813	0.850	0.444	0.612	0.668

SBM content	Mannanase	Histidine	Glycine	Aspartic acid	Glutamic acid	Cystine	Alanine	Serine	Proline	Tyrosine
35.66% SBM	0 mg/kg	0.875	0.484	0.832	0.896	0.757	0.831	0.836	0.844	0.858
35.66% SBM	100 mg/kg	0.892	0.549	0.861	0.907	0.781	0.862	0.861	0.866	0.892
17.83% SBM	0 mg/kg	0.846	0.483	0.823	0.894	0.768	0.828	0.828	0.832	0.874
17.83% SBM	100 mg/kg	0.860	0.497	0.832	0.900	0.790	0.842	0.837	0.842	0.872
8.92% SBM	0 mg/kg	0.853	0.502	0.832	0.904	0.780	0.856	0.845	0.851	0.871
8.92% SBM	100 mg/kg	0.852	0.543	0.835	0.908	0.802	0.867	0.851	0.857	0.890
SEM		0.005	0.012	0.005	0.003	0.006	0.004	0.004	0.004	0.004
Main effect
Mannanase	0 mg/kg	0.858	0.490^b	0.829	0.898	0.768^b	0.839^b	0.836^b	0.842^b	0.867^b
Mannanase	100 mg/kg	0.868	0.530^a	0.843	0.905	0.791^a	0.857^a	0.850^a	0.855^a	0.885^a
SBM content	35.66% SBM	0.884^a	0.516	0.846	0.902	0.769	0.847^ab	0.849	0.855	0.875
	17.83% SBM	0.853^b	0.490	0.827	0.897	0.779	0.835^b	0.832	0.837	0.873
	8.92% SBM	0.853^b	0.523	0.833	0.906	0.791	0.862^a	0.848	0.854	0.880
p-value
Mannanase		0.243	0.096	0.119	0.203	0.062	0.015	0.083	0.089	0.020
SBM content		0.005	0.470	0.202	0.450	0.329	0.019	0.154	0.106	0.665
Mannanase × SBM		0.612	0.665	0.444	0.865	0.998	0.450	0.522	0.631	0.124
^{a, b} The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

SBM content	Mannanase	IL-1β	IL-6	IL-8	IL-10	IL-18	TNF-a	MyD88	NF-kB	TLR-4
35.66% SBM	0 mg/kg	1.000^a	1.000	1.000	1.000	1.000^a	1.000	1.000	1.000^a	1.000
35.66% SBM	100 mg/kg	0.546^b	0.302	0.658	1.274	0.547^b	0.829	0.754	0.612^bc	0.751
17.83% SBM	0 mg/kg	0.434^b	0.709	0.385	0.617	0.414^bc	0.867	0.685	0.575^bc	0.612
17.83% SBM	100 mg/kg	0.436^b	0.345	0.269	0.843	0.226^c	0.809	0.520	0.330^c	0.555
8.92% SBM	0 mg/kg	0.434^b	0.734	0.337	0.690	0.295^bc	0.912	0.941	0.541^bc	0.885
8.92% SBM	100 mg/kg	0.768^ab	0.647	0.426	1.141	0.579^b	0.700	0.556	0.679^b	0.575
SEM		0.052	0.076	0.055	0.088	0.054	0.062	0.053	0.051	0.048
Main effect
mannanase	0 mg/kg	0.623	0.815^a	0.574	0.769^b	0.570	0.926	0.876^a	0.705^a	0.832^a
mannanase	100 mg/kg	0.583	0.431^b	0.451	1.086^a	0.451	0.779	0.610^b	0.540^b	0.627^b
SBM content	35.66% SBM	0.773	0.651	0.829^a	1.137	0.774	0.914	0.877^a	0.806^a	0.876^a
	17.83% SBM	0.435	0.527	0.327^b	0.730	0.320	0.838	0.603^b	0.453^b	0.584^b
	8.92% SBM	0.601	0.691	0.382^b	0.915	0.437	0.806	0.749^ab	0.610^ab	0.730^ab
p-value
Mannanase		0.650	0.010	0.173	0.071	0.159	0.258	0.009	0.068	0.023
SBM content		0.011	0.626	< 0.001	0.164	< 0.001	0.779	0.078	0.008	0.031
Mannanase × SBM		0.003	0.229	0.150	0.852	0.003	0.879	0.646	0.052	0.470
^{a, b, c} The data in the same row with shoulder labels containing different letters indicate significant differences (p < 0.05).

{{lists.name}}

Impact of mannanase on broiler performance, intestinal health, and energy utilization with varying soybean meal levels

Abstract

Rights and permissions

References

About this article

Cite this article

Article Metrics

Access History

Other Articles By Authors