Figures (9)  Tables (7)

    • Figure 1. 

      Spatial layout of measurement locations. (a) Cages numbered 22 to 24 were assigned to the cooling pad zone (CPZ); Cages 67 to 69 represented the proximal cooling pad zone (PCPZ). Similarly, Cages 112 to 114 corresponded to the proximal exhaust fan zone (PEFZ), and Cages 157 to 159 were categorized as being in the exhaust fan zone (EFZ). (b) Vertically, tiers were denoted by the numerals 1, 3, 5, and 7, indicating the first, third, fifth, and seventh levels. The column positions were marked as C1–C4, where C1 refers to the column closest to the henhouse wall.

    • Figure 2. 

      Average temperatures at different measurement locations (a) and between the CHS and CON groups (b). (a) The x-axis denotes the sequential order of the 64 sampling locations, whereas the y-axis depicts the temperature measurements obtained at each location. Highlighted points indicate sites selected for further investigation. (b) A comparison of the average temperatures between the CHS and CON groups. Abbreviations: CHS, chronic heat stress group; CON, control group.

    • Figure 3. 

      Volcano plots illustrating differentially expressed genes (DEGs) in the (a) pituitary and (b) liver samples. Red and blue dots denote upregulated and downregulated genes, respectively; gray dots indicate those without significant differential expression.

    • Figure 4. 

      GO and KEGG enrichment analysis of DEGs in pituitary tissues. (a) Top 30 GO terms of the DEGs. (b) Top 20 significantly enriched KEGG pathways of the DEGs.

    • Figure 5. 

      GO and KEGG enrichment analysis of DEGs in liver tissues. (a) Top 30 GO terms of the DEGs. (b) Top 20 significantly enriched KEGG pathways of the DEGs.

    • Figure 6. 

      Validation of the differentially expressed genes in (a) pituitary and (b) liver samples. The horizontal axis indicates the DEGs selected for the qPCR analysis; the vertical axis represents the log2(fold change) values between the CHS and CON groups. Abbreviations: CHS group, chronic heat stress group; CON group, control group.

    • Figure 7. 

      Error curves of the laying rate prediction model under varying numbers of decision trees. The horizontal axis indicates the number of trees; the vertical axis denotes the prediction error.

    • Figure 8. 

      Comparison of actual and predicted values of the model. The horizontal axis indicates the number of predicted samples; the vertical axis indicates the laying rate.

    • Figure 9. 

      Prediction error of the model. The horizontal axis indicates the number of predicted samples; the vertical axis indicates the prediction error of the laying rate.

    • Columns Vertical direction
      (tiers)      		 Horizontal direction
      CPZ PCPZ PEFZ EFZ
      C1 7 34 36 38 40
      5 33 35 37 39
      3 2 4 6 8
      1 1 3 5 7
      C2 7 48 46 44 42
      5 47 45 43 41
      3 16 14 12 10
      1 15 13 11 9
      C3 7 50 52 54 56
      5 49 51 53 55
      3 18 20 22 24
      1 17 19 21 23
      C4 7 64 62 60 58
      5 63 61 59 57
      3 32 30 28 26
      1 31 29 27 25
      CPZ, cooling pad zone; PCPZ, proximal cooling pad zone; PEFZ, proximal exhaust fan zone; EFZ, exhaust fan zone. C1, first column; C2, second column; C3, third column; C4, fourth column (numbered sequentially from the henhouse wall).

      Table 1. 

      The specific mapping of each number to the measurement location.

    • Target geneGenBank numberPrimer sequence (5'–3')T (°C)Product size (bp)
      FAM19A1XM_046926508.1F: GCTCTGCTCTTGGCTGGATTAC58.52129
      R: GCTGCTGGAAAGTGTGATGGAG58.92129
      RSPH1XM_040659723.2F: TGTTGGTGGTTGGGTAAATGGAATC57.46108
      R:TTGCCACGACCTACAGGAGTTC59.47108
      CIDEANM_001195123.2F: CATCTGCCTCTGAACCACATACATC57.56104
      R: TTCTACAGGAACACCATTGGAAACTAC56.28104
      CIDECXM_046925330.1F: TGGAGACGGAGGCTTTCTTCTG59.3130
      R: CGGCGGGACGGCTTGTG64.34130
      DMRT2XM_046936552.1F: ACCGCCCTATTCCAGCAGATG60.08118
      R: AGCATAATGTTCTCCAACTCCTTATCG56.2118
      DYL2XM_040684994.2F: AGGGAGTTTGACAGGCGGTAC59.84102
      R: GTAGGCGAAGATGAAGTGGTTGG58.21102
      COQ10BNM_001389593.2F: CCAAGGAGGCAACTACATACTACAC57.07116
      R: GCTGTGGGAGGAGGGAGAATG60.73116
      GADD45BXM_046933968.1F: GGACGGATTCGGCTGAACATC58.9106
      R: TCCCAGCGGCTCCAATGC62.21106
      LOC416655XM_040684134.2F: AGAAGAGGAGGAGGAGGAGGATG59.92109
      R: CAGGAGCCGCAGTGTGGTC62.49109
      RHOBTB1XM_046920122.1F: TTACAAGGCAAGCAAGCGACAG58.38119
      R: ATCACTGACCAAGAATTAAGGAGACTG55.95119
      C9ORF152XM_046910132.1F: GATCAACCTGTCTCCTATTAGCCAAG56.84100
      R: TGCAGTCCAACATCTTCCTTACAAC57.08100
      LOC112532115XR_005848662.1F: TGTCCATTCCTGCTCCTCTTCTC58.73109
      R: TGCACACGTCTGGTCCATCC60.62109
      β-actinNM_205518.1F: TATTGCTGCGCTCGTTGTTG56.39127
      R: ACCAACCATCACACCCTGAT56.34127

      Table 2. 

      Details of the target genes and the corresponding primer sequences used in qPCR.

    • Performances CHS group CON group p-Value
      Body weight (g) 1,629.32 ± 45.06b 1,836.52 ± 39.99a 0.002
      Laying rate (%) 67.80 ± 1.18b 86.53 ± 1.11a < 0.001
      Egg weight (g) 53.77 ± 0.27b 61.16 ± 0.16a < 0.001
      Egg shape index (mm:mm) 1.33 ± 0.01 1.31 ± 0.01 0.056
      Shell color 47.92 ± 0.93 48.94 ± 0.78 0.403
      Shell thickness (mm) 0.31 ± 0.01b 0.35 ± 0.00a < 0.001
      Shell strength (kg/cm2) 3.50 ± 0.12b 4.44 ± 0.09a < 0.001
      Yolk weight (g) 14.09 ± 0.35b 16.99 ± 0.24a < 0.001
      Yolk color 10.98 ± 0.15 11.20 ± 0.16 0.309
      Albumen height (mm) 6.57 ± 0.18a 6.07 ± 0.17b 0.043
      Haugh units 81.73 ± 1.23a 75.13 ± 1.70b 0.003
      CHS group, chronic heat stress group; CON group, control group. Results within a row with different superscripts differ significantly (p < 0.05)

      Table 3. 

      Comparison of production performances and egg quality between the CHS and CON groups.

    • Indicators CHS group CON group p-Value
      Biochemical indicators FSH (ng/mL) 30.99 ± 0.95b 41.83 ± 3.54a 0.018
      LH (pg/mL) 2,965.8 ± 150.41b 3,735.43 ± 185.42a 0.006
      HSP 70 (ng/mL) 12.5 ± 1.12 14.62 ± 1.34 0.245
      CORT 49.75 ± 6.91 52.07 ± 5.96 0.803
      Antibody titers H5 Re-13 (log2) 7.25 ± 0.31 7.89 ± 0.23 0.100
      H5 Re-14 (log2) 8.13 ± 0.24b 9.05 ± 0.24a 0.010
      H7 (log2) 7.50 ± 0.31 8.20 ± 0.29 0.120
      H9 (log2) 9.81 ± 0.26 10.05 ± 0.18 0.460
      ND (log2) 7.63 ± 0.35 7.74 ± 0.35 0.820
      CHS group, chronic heat stress group; CON group, control group. Results within a row with different superscripts differ significantly (p < 0.05)).

      Table 4. 

      Comparison of biochemical indicators and antibody titers between the CHS and CON groups.

    • Environmental variables CHS group CON group p-Value
      T (°C) 32.17 ± 0.07a 27.60 ± 0.13b < 0.001
      RH (%) 73.31 ± 0.38b 89.04 ± 0.73a < 0.001
      AV (m/s) 1.72 ± 0.03a 1.43 ± 0.06b < 0.001
      LI (lx) 8.93 ± 0.27a 8.06 ± 0.26b 0.021
      NH3 (mg/m3) 0.97 ± 0.09a 0.24 ± 0.05b < 0.001
      CO2 (mg/m3) 2,686.75 ± 17.34a 1,714.74 ± 13.38b < 0.001
      PM2.5 (ug/m3) 2.48 ± 0.05a 1.52 ± 0.04b < 0.001
      CHS group, chronic heat stress group; CON group, control group. Results within a row with different superscripts differ significantly (p < 0.05).

      Table 5. 

      Comparison of the local environment between the CHS and CON groups.

    • Perfomance T RH AV LI NH3 CO2 PM2.5
      Laying rate −0.65233* 0.55789* −0.27821* −0.07959 −0.16376* −0.6208* −0.52812*
      The asterisk (*) indicates significant correlation.

      Table 6. 

      Correlation between environmental variables and laying rate.

    • Dataset R2 MSE RMSE MAE
      Training subset 0.92926 18.5262 4.3042 3.2353
      Testing subset 0.92339 16.5915 4.0733 3.0166

      Table 7. 

      Error statistics of model predictions