Search
2023 Volume 3
Article Contents
ARTICLE   Open Access    

Genetic diversity analysis and fingerprint construction for 45 Chinese Zoysia germplasm collections

More Information
  • Zoysia spp. germplasm exhibit genetic variation between and within species. A comprehension of the genetic diversity of Zoysia germplasm could enable the effective utilization of these germplasms in future breeding endeavors. Ten simple sequence repeats (SSR) primer pairs and nine sequence-related amplified polymorphism (SRAP) primer pairs were used to analyze genetic diversity and construct DNA fingerprints for 45 Chinese Zoysia germplasm collections. We detected 231 SSR polymorphic bands and 149 SRAP polymorphic bands with 97.18% and 93.43% polymorphism ratios, respectively. The genetic similarity coefficient of the 45 germplasm collections ranged from 0.623 to 0.856, with an average of 0.727. Forty-five germplasm collections were divided into six major clusters when the genetic similarity coefficient was 0.71 based on the unweighted pair group method with the arithmetic averaging (UPGMA) method. Both SSR and SRAP molecular marker systems can be used to identify all germplasm collections, the SSR primer pair (Xgwm234-5B) and SRAP primer pairs (Me3-Em1 and Me3-Em2) can effectively distinguish 45 Zoysia spp. accessions. Collectively, we utilized both SSR and SRAP molecular markers to generate DNA fingerprints in this study providing a theoretical foundation for germplasm conservation and assisting in selecting and breeding new varieties of Zoysia.
  • 加载中
  • [1] Bae TW, Vanjildorj E, Song SY, Nishiguchi S, Yang SS, et al. 2008. Environmental risk assessment of genetically engineered herbicide-tolerant Zoysia japonica. Journal of Environmental Quality 37:207−18 doi: 10.2134/jeq2007.0128

    CrossRef   Google Scholar

    [2] Choi JS, Yang GM, Oh CJ, Bea EJ. 2012. Morphological characteristics and growth rate of medium-leaf type zoysiagrasses collected at major sod production area in S. Korea. Asian Journal of Turfgrass Science 26:1−7

    Google Scholar

    [3] Guo H, Xuan J, Liu J, Zhang, Y, Zheng, Y. 2012. Association of molecular markers with cold tolerance and green period in zoysiagrass (Zoysia Willd. ). Breeding Science 62:320−27 doi: 10.1270/jsbbs.62.320

    CrossRef   Google Scholar

    [4] Tanaka H, Tokunaga R, Muguerza M, Kitazaki Y, Hashiguchi M, et al. 2016. Genetic structure and speciation of zoysiagrass ecotypes collected in Japan. Crop Science 56:818−26 doi: 10.2135/cropsci2015.04.0249

    CrossRef   Google Scholar

    [5] Bae EJ, Han JJ, Choi SM, Lee KS, Park YB, et al. 2016. Seed yields and germination rates of native ecotype collections for the development of high-yield seeded variety of zoysiagrass in Korea. Weed & Turfgrass Science 5:95−100 doi: 10.5660/WTS.2016.5.2.95

    CrossRef   Google Scholar

    [6] Zhang J, Unruh JB, Kenworthy K, Erickson J, Christensen CT, et al. 2016. Phenotypic plasticity and turf performance of zoysiagrass in response to reduced light intensities. Crop Science 56:1337−48 doi: 10.2135/cropsci2015.09.0570

    CrossRef   Google Scholar

    [7] Kunwanlee P, Tanaka H, Inoue T, Hashiguchi M, Muguerza M, et al. 2018. Turf quality trait and genetic fingerprinting of a new zoysiagrass cultivar in Japan. Journal of Japanese Society of Turfgrass Science 47:15−24 doi: 10.11275/turfgrass.47.1_15

    CrossRef   Google Scholar

    [8] Gouveia BT, Rios EF, Nunes JAR, Gezan SA, Munoz PR, et al. 2021. Multispecies genotype × environment interaction for turfgrass quality in five turfgrass breeding programs in the southeastern United States. Crop Science 61:3080−96 doi: 10.1002/csc2.20421

    CrossRef   Google Scholar

    [9] Engelke MC, Colbaugh PF, Reinert JA, Marcum KB, White RH, et al. 2002. Registration of "Diamond" zoysiagrass. Crop Science 42:304−05 doi: 10.2135/cropsci2002.3040

    CrossRef   Google Scholar

    [10] Schwartz BM, Harris-Shultz KR, Contreras RN, Hans CS, Jackson SA. 2013. Creation of hexaploid and octaploid zoysiagrass using colchicine and breeding. Crop Science 53:2218−24 doi: 10.2135/cropsci2013.02.0124

    CrossRef   Google Scholar

    [11] Ebina M, Kobayashi M, Tonogi H, Tsuruta S, Akamine H, et al. 2017. Evaluation and breeding of zoysiagrass using Japan's natural genetic resources. International Turfgrass Society Research Journal 13:40−43 doi: 10.2134/itsrj2017.02.0104

    CrossRef   Google Scholar

    [12] Forbes I Jr. 1952. Chromosome numbers and hybrids in Zoysia. Agronomy Journal 44:194−99 doi: 10.2134/agronj1952.00021962004400040008x

    CrossRef   Google Scholar

    [13] Kimball JA, Zuleta MC, Kenworthy KE, Lehman VG, Harris-Shultz KR, et al. 2013. Genetic relationships in Zoysia species and the identification of putative interspecific hybrids using simple sequence repeat markers and inflorescence traits. Crop Science 53:285−95 doi: 10.2135/cropsci2012.04.0218

    CrossRef   Google Scholar

    [14] Cole CT. 2003. Genetic variation in rare and common plants. Annual Review of Ecology, Evolution, and Systematics 34:213−37 doi: 10.1146/annurev.ecolsys.34.030102.151717

    CrossRef   Google Scholar

    [15] Eagles HA, Bariana HS, Ogbonnaya FC, Rebetzke GJ, Hollamby GJ, et al. 2001. Implementation of markers in Australian wheat breeding. Australian Journal of Agricultural Research 52:1349−56 doi: 10.1071/AR01067

    CrossRef   Google Scholar

    [16] Kalia RK, Rai MK, Kalia S, Singh R, Dhawan AK. 2011. Microsatellite markers: an overview of the recent progress in plants. Euphytica 177:309−34 doi: 10.1007/s10681-010-0286-9

    CrossRef   Google Scholar

    [17] Li G, Quiros CF. 2001. Sequence-related amplified polymorphism (SRAP), a new marker system based on a simple PCR reaction: its application to mapping and gene tagging in Brassica. Theoretical and Applied Genetics 103:455−61 doi: 10.1007/s001220100570

    CrossRef   Google Scholar

    [18] Uzun A, Yesiloglu T, Aka-Kacar Y, Tuzcu O, Gulsen O. 2009. Genetic diversity and relationships within Citrus and related genera based on sequence related amplified polymorphism markers (SRAPs). Scientia Horticulturae 121:306−12 doi: 10.1016/j.scienta.2009.02.018

    CrossRef   Google Scholar

    [19] Tan M, Ling Y, Peng Y, Li Z. 2022. Evaluation of genetic diversity and drought tolerance among thirty-three dichondra (Dichondra repens) genotypes. Grass Research 2:8 doi: 10.48130/GR-2022-0008

    CrossRef   Google Scholar

    [20] Li X, Qiao L, Chen B, Zheng Y, Zhi C, et al. 2022. SSR markers development and their application in genetic diversity evaluation of garlic (Allium sativum) germplasm. Plant Diversity 44:481−91 doi: 10.1016/j.pld.2021.08.001

    CrossRef   Google Scholar

    [21] Chen X, Wang H, Yang X, Jiang J, Ren G, et al. 2020. Small-scale alpine topography at low latitudes and high altitudes: refuge areas of the genus Chrysanthemum and its allies. Horticulture Research 7:184 doi: 10.1038/s41438-020-00407-9

    CrossRef   Google Scholar

    [22] Riangwong K, Wanchana S, Aesomnuk W, Saensuk C, Nubankoh P, et al. 2020. Mining and validation of novel genotyping-by-sequencing (GBS)-based simple sequence repeats (SSRs) and their application for the estimation of the genetic diversity and population structure of coconuts (Cocos nucifera L. ) in Thailand. Horticulture Research 7:156 doi: 10.1038/s41438-020-00374-1

    CrossRef   Google Scholar

    [23] Zhang J, Li H, Jiang Y, Li H, Zhang Z, et al. 2020. Natural variation of physiological traits, molecular markers, and chlorophyll catabolic genes associated with heat tolerance in perennial ryegrass accessions. BMC Plant Biology 20:520 doi: 10.1186/s12870-020-02695-8

    CrossRef   Google Scholar

    [24] Harris-Shultz KR, Milla-Lewis S, Patton AJ, Kenworthy K, Chandra A, et al. 2014. Detection of DNA and ploidy variation within vegetatively propagated zoysiagrass cultivars. Journal of the American Society for Horticultural Science 139:547−52 doi: 10.21273/JASHS.139.5.547

    CrossRef   Google Scholar

    [25] Guo H, Wang Y, Zhang B, Li D, Chen J, et al. 2019. Association of candidate genes with drought tolerance traits in zoysiagrass germplasm. Journal of Plant Physiology 237:61−71 doi: 10.1016/j.jplph.2019.04.008

    CrossRef   Google Scholar

    [26] Tanaka H, Hirakawa H, Kosugi S, Nakayama S, Ono A, et al. 2016. Sequencing and comparative analyses of the genomes of zoysiagrasses. DNA Research 23:171−80 doi: 10.1093/dnares/dsw006

    CrossRef   Google Scholar

    [27] Xue D, Guo H, Zheng Y, Chen X, Liu J. 2009. Hybrid identification of progenies of Zoysia crosses by SRAP marker. Acta Prataculturae Sinica 18:72−79 doi: 10.3321/j.issn:1004-5759.2009.01.011

    CrossRef   Google Scholar

    [28] Anderson S. 2000. Taxonomy of Zoysia (Poaceae): Morphological and Molecular Variation. Dissertation. Texas A&M University, U. S. Number of Pages 143-67.
    [29] Li M, Yuyama N, Hirata M, Wang Y, Han J, et al. 2010. An integrated SSR based linkage map for Zoysia matrella L. and Z. japonica Steud. Molecular Breeding 26:467−76 doi: 10.1007/s11032-009-9386-4

    CrossRef   Google Scholar

    [30] Li M, Yuyama N, Hirata M, Han J, Wang Y, et al. 2009. Construction of a high-density SSR marker-based linkage map of zoysiagrass (Zoysia japonica Steud.). Euphytica 170:327−38 doi: 10.1007/s10681-009-9990-8

    CrossRef   Google Scholar

    [31] Xie, Liu L, Fu J, Li H. 2012. Genetic diversity in Chinese natural zoysiagrass based on inter-simple sequence repeat (ISSR) analysis. African Journal of Biotechnology 11:7659−69 doi: 10.5897/AJB11.3743

    CrossRef   Google Scholar

    [32] Moore KA, Zuleta MC, Patton AJ, Schwartz BM, Aranaz G, et al. 2017. SSR allelic diversity shifts in zoysiagrass (Zoysia spp. ) cultivars released from 1910 to 2016. Crop Science 57:S-1−S-12 doi: 10.2135/cropsci2016.06.0452

    CrossRef   Google Scholar

    [33] Jiang B, Wang D, Zhou J, Cai J, Jiang J, et al. 2023. First report of corn ear rot caused by Fusarium asiaticum in China. Plant Disease 107:4 doi: 10.1094/PDIS-08-22-1934-PDN

    CrossRef   Google Scholar

    [34] Liu L, Guo W, Zhu X, Zhang T. 2003. Inheritance and fine mapping of fertility restoration for cytoplasmic male sterility in Gossypium hirsutum L. Theoretical and Applied Genetics 106:461−69 doi: 10.1007/s00122-002-1084-0

    CrossRef   Google Scholar

    [35] Röder MS, Korzun V, Wendehake K, Plaschke J, Tixier M, et al. 1998. A microsatellite map of wheat. Genetics 149:2007−23 doi: 10.1093/genetics/149.4.2007

    CrossRef   Google Scholar

    [36] Tsuruta SI, Hashiguchi M, Ebina M, Matsuo T, Yamamoto T, et al. 2005. Development and characterization of simple sequence repeat markers in Zoysia japonica Steud. Grassland Science 51:249−57 doi: 10.1111/j.1744-697X.2005.00033.x

    CrossRef   Google Scholar

    [37] Bassam BJ, Caetano-Anollés G, Gresshoff PM. 1991. Fast and sensitive silver staining of DNA in polyacrylamide gels. Analytical Biochemistry 196:80−83 doi: 10.1016/0003-2697(91)90120-I

    CrossRef   Google Scholar

    [38] Liu L, Liu G, Gong Y, Dai W, Wang Y, et al. 2007. Evaluation of genetic purity of F1 hybrid seeds in cabbage with RAPD, ISSR, SRAP, and SSR markers. HortScience 42:724−27 doi: 10.21273/HORTSCI.42.3.724

    CrossRef   Google Scholar

    [39] Dice LR. 1945. Measures of the amount of ecologic association between species. Ecology 26:297−302 doi: 10.2307/1932409

    CrossRef   Google Scholar

    [40] Weng J, Fan M, Lin C, Liu Y, Huang S. 2007. Genetic variation of Zoysia as revealed by random amplified polymorphic DNA (RAPD) and isozyme pattern. Plant Production Science 10:80−85 doi: 10.1626/pps.10.80

    CrossRef   Google Scholar

    [41] Kimball JA, Zuleta MC, Kenworthy KE, Lehman VG, Milla-Lewis S. 2012. Assessment of genetic diversity in Zoysia species using amplified fragment length polymorphism markers. Crop Science 52:360−70 doi: 10.2135/cropsci2011.05.0252

    CrossRef   Google Scholar

    [42] Mosca E, Eckert AJ, Di Pierro EA, Rocchini D, La Porta N, et al. 2012. The geographical and environmental determinants of genetic diversity for four alpine conifers of the European Alps. Molecular Ecology 21:5530−45 doi: 10.1111/mec.12043

    CrossRef   Google Scholar

    [43] Harris-Shultz KR, Schwartz BM, Paterson AH, Brady JA. 2010. Identification and mapping of nucleotide binding site-leucine-rich repeat resistance gene analogs in bermudagrass. Journal of the American Society for Horticultural Science 135:74−82 doi: 10.21273/JASHS.135.1.74

    CrossRef   Google Scholar

    [44] Harris-Shultz KR, Raymer P, Scheffler BE, Arias RS. 2013. Development and characterization of seashore paspalum SSR markers. Crop Science 53:2679−85 doi: 10.2135/cropsci2012.11.0671

    CrossRef   Google Scholar

    [45] Hong Y, Pandey MK, Lu Q, Liu H, Gangurde SS, et al. 2021. Genetic diversity and distinctness based on morphological and SSR markers in peanut. Agronomy Journal, 113:4648−60 doi: 10.1002/agj2.20671

    CrossRef   Google Scholar

    [46] Liu Y, Guo H, Wang Y, Shi J, Li D, et al. 2019. Measurement of genetic diversity of Chinese seashore paspalum resources through morphological and sequence-related amplified polymorphism analysis. Journal of the American Society for Horticultural Science 144:379−86 doi: 10.21273/JASHS04700-19

    CrossRef   Google Scholar

    [47] Tian H, Wang F, Zhao J, Yi H, Wang L, et al. 2015. Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties. Molecular Breeding 35:136 doi: 10.1007/s11032-015-0335-0

    CrossRef   Google Scholar

    [48] Liu L, Zhao L, Gong Y, Wang M, Chen L, et al. 2008. DNA fingerprinting and genetic diversity analysis of late-bolting radish cultivars with RAPD, ISSR and SRAP markers. Scientia Horticulturae 116:240−47 doi: 10.1016/j.scienta.2007.12.011

    CrossRef   Google Scholar

    [49] Liu J, Qu J, Hu K, Zhang L, Li J, et al. 2015. Development of genomewide simple sequence repeat fingerprints and highly polymorphic markers in cucumbers based on next-generation sequence data. Plant Breeding 134:605−11 doi: 10.1111/pbr.12304

    CrossRef   Google Scholar

    [50] Pradhan A, Yan G, Plummer JA. 2004. Development of DNA fingerprinting keys for the identification of radish cultivars. Australian Journal of Experimental Agriculture 44:95−102 doi: 10.1071/EA03031

    CrossRef   Google Scholar

  • Cite this article

    Wang M, Chen Q, Yu J, Liu J, Tate TM, et al. 2023. Genetic diversity analysis and fingerprint construction for 45 Chinese Zoysia germplasm collections. Grass Research 3:10 doi: 10.48130/GR-2023-0010
    Wang M, Chen Q, Yu J, Liu J, Tate TM, et al. 2023. Genetic diversity analysis and fingerprint construction for 45 Chinese Zoysia germplasm collections. Grass Research 3:10 doi: 10.48130/GR-2023-0010

Figures(1)  /  Tables(7)

Article Metrics

Article views(8240) PDF downloads(1362)

ARTICLE   Open Access    

Genetic diversity analysis and fingerprint construction for 45 Chinese Zoysia germplasm collections

Grass Research  3 Article number: 10  (2023)  |  Cite this article

Abstract: Zoysia spp. germplasm exhibit genetic variation between and within species. A comprehension of the genetic diversity of Zoysia germplasm could enable the effective utilization of these germplasms in future breeding endeavors. Ten simple sequence repeats (SSR) primer pairs and nine sequence-related amplified polymorphism (SRAP) primer pairs were used to analyze genetic diversity and construct DNA fingerprints for 45 Chinese Zoysia germplasm collections. We detected 231 SSR polymorphic bands and 149 SRAP polymorphic bands with 97.18% and 93.43% polymorphism ratios, respectively. The genetic similarity coefficient of the 45 germplasm collections ranged from 0.623 to 0.856, with an average of 0.727. Forty-five germplasm collections were divided into six major clusters when the genetic similarity coefficient was 0.71 based on the unweighted pair group method with the arithmetic averaging (UPGMA) method. Both SSR and SRAP molecular marker systems can be used to identify all germplasm collections, the SSR primer pair (Xgwm234-5B) and SRAP primer pairs (Me3-Em1 and Me3-Em2) can effectively distinguish 45 Zoysia spp. accessions. Collectively, we utilized both SSR and SRAP molecular markers to generate DNA fingerprints in this study providing a theoretical foundation for germplasm conservation and assisting in selecting and breeding new varieties of Zoysia.

    • As a perennial warm-season grass, Zoysia (Zoysia spp.) is recognized for its low maintenance requirements as well as relatively high tolerance to drought, disease, and traffic, and is widely cultivated for athletic fields, home lawns, and other recreational sites, particularly in east Asia[1]. With the rapid development of the turf industry, it is extensively recognized that germplasm resources are hugely important. Therefore, a large number of researches are focussed on the collection[25], evaluation[68], and breeding[911] of Zoysia spp.

      Zoysia species exhibit a high rate of outcrossing and are prone to interspecific hybridization, resulting in a wide range of genetic variation among Zoysia plants[12]. Kimball et al.[13] identified interspecific hybridization and hypothesized that these hybrids were the result of introgression between species through common breeding methods of Zoysia, including directed hybridization of selected parents and cross-pollination in open cross areas. Genetic background analysis of abundant germplasm is an important prerequisite for identifying parents and breeding Zoysia varieties[14]. Traditionally morphological identification has several drawbacks due to the susceptibility to environmental factors and plant growth period as well as the limited morphological indexes. Furthermore, some germplasm are difficult to differentiate based on phenotype alone[15]. Molecular markers are an effective means to grasp the genetic information of germplasm. Among several common molecular markers, simple sequence repeats (SSRs) are widely used molecular markers in plant genetics and breeding, due to their multiallelic, codominant inheritance and extensive genome coverage[16]. Sequence-related amplified polymorphism (SRAP) was developed by Li & Quiros[17] in Brassica. This method is advantageous due to its simplicity, reasonable throughput rate, disclosure of numerous codominant markers, and targeting of open reading frames (ORFs)[18]. Both marker systems have been applied to a range of fields, including the analysis of genetic diversity of germplasm[1922], the identification of cultivar and marker-trait association[23]. SSR and SRAP have been reported to be effectively utilized to examine the genetic diversity[4], analyze genetic similarity among cultivars[24], and identify molecular markers linked with quantitative trait loci for biotic and abiotic stress tolerance in Zoysia[3, 25]. These markers also serve as a potent tool for constructing DNA fingerprints[7, 26, 27].

      The evaluation and improvement of germplasm are of great significance for the effective utilization of these resources. Previous researchers investigated the genetic variation of some Zoysia germplasm. Anderson[28] measured inflorescence traits, morphological characteristics, and restricted fragment length polymorphisms (RFLPs) to evaluate the genetic and morphological variations in 11 species of Zoysia. Li et al.[29] reported a linkage map of Zoysia matrella based on SSR markers, combined the previously reported SSR linkage maps of different Zoysia species (Z. japonica and Z. matrella) and different mapping populations (F1, S2, and F2)[30] to construct a complete SSR genetic linkage map. Xie et al.[31] conducted a study to analyze the genetic diversity and relationships of 84 Zoysia germplasms using inter-simple sequence repeat (ISSR) markers. Moore et al.[32] analyzed changes in levels of allelic diversity at the gene and population levels in 40 Zoysia cultivars released between 1910 and 2016 using SSR markers.

      In this study, 45 Chinese Zoysia germplasm collections were analyzed by SSR and SRAP markers. The results of these analyses were used to clarify the genetic relationship, analyze the genetic diversity of 45 Chinese Zoysia germplasm collections, and construct the fingerprint to distinguish breeding lines from the two commercially available cultivars at the molecular level. The aim of this study was to provide a theoretical basis for the development, evaluation, and breeding of Zoysia germplasm.

    • Forty-five Chinese Zoysia germplasm collections were used for the study, among which 38 were collected from the provinces of Liaoning, Anhui, Zhejiang, and Hainan in China, five were breeding lines from radiation mutagenesis and two commercial Z. japonica cultivars, 'Lanyin No. 3' and 'Qingdao' (Table 1). Forty-five Zoysia germplasm collections were grown in the resource nursery of Turf Experiment Station of Nanjing Agricultural University, located at 119°14′38″ east longitude and 31°49′46″ north latitude, with a subtropical monsoon climate and an average annual temperature of 15.2 °C. A randomized block design was utilized with each germplasm planted in an area of 3 m × 3 m with three replicates and plots spaced 2 m apart in August, 2020. About 100 stolons were planted evenly in each plot with 2−3 stem nodes for each stolon. Plants were watered twice weekly and fertilized once a month. Plants were not trimmed in 2021 in order to measure morphological indexes, and trimmed once a week in 2022 to evaluate turf density.

      Table 1.  List of Chinese Zoysia germplasm collections used in this study.

      No.Germplasm IDTypeSpeciesSource
      1ZG003Breeding materialZ. sp.Liaoning
      2ZG004Breeding materialZ. sp.Anhui
      3ZG007Breeding materialZ. sinicaAnhui
      4ZG008Breeding materialZ. sinicaRadiation mutagenesis
      (parent from Anhui)
      5ZG009Breeding materialZ. matrellaJiangsu
      6ZG011Breeding materialZ. pacificaZhejiang
      7ZG013Breeding materialZ. sp.Anhui
      8ZG015Breeding materialZ. sinicaAnhui
      9ZG017Breeding materialZ. sp.Anhui
      10ZG018Breeding materialZ. sp.Anhui
      11ZG021Breeding materialZ. sp.Anhui
      12ZG022Breeding materialZ. sp.Anhui
      13ZG023Breeding materialZ. matrellaAnhui
      14ZG025Breeding materialZ. sp.Anhui
      15ZG026Breeding materialZ. matrellaAnhui
      16ZG028Breeding materialZ. sp.Anhui
      17ZG029Breeding materialZ. sp.Zhejiang
      18ZG030Breeding materialZ. matrellaZhejiang
      19ZG032Breeding materialZ. sp.Zhejiang
      20ZG035Breeding materialZ. sp.Zhejiang
      21ZG037Breeding materialZ. sp.Zhejiang
      22ZG038Breeding materialZ. sp.Zhejiang
      23ZG040Breeding materialZ. sp.Zhejiang
      24ZG041Breeding materialZ. sp.Anhui
      25ZG043Breeding materialZ. sp.Anhui
      26ZG044Breeding materialZ. sp.Anhui
      27ZG046Breeding materialZ. sinicaHainan
      28ZG047Breeding materialZ. sp.Hainan
      29ZG048Breeding materialZ. pacificaHainan
      30ZG049Breeding materialZ. sp.Hainan
      31ZG050Breeding materialZ. matrellaHainan
      32ZG053Breeding materialZ. pacificaHainan
      33ZG056Breeding materialZ. pacificaAnhui
      34ZG057Breeding materialZ. sp.Anhui
      35ZG058Breeding materialZ. matrellaAnhui
      36ZG059Breeding materialZ. sinicaRadiation mutagenesis
      (parent from Anhui)
      37ZG060Breeding materialZ. sp.Anhui
      38ZG061Breeding materialZ. sp.Anhui
      39ZG062Breeding materialZ. sp.Anhui
      40ZG063Breeding materialZ. sp.Anhui
      41ZG081Breeding materialZ. japonicaRadiation mutagenesis
      (parent from Anhui)
      42ZG082Breeding materialZ. japonicaRadiation mutagenesis
      (parent from Anhui)
      43ZG083Breeding materialZ. japonicaRadiation mutagenesis
      (parent from Anhui)
      44Lanyin
      No. 3
      CultivarZ. japonicaGansu
      45QingdaoCultivarZ. japonicaShandong
    • Morphological data were collected on the 15th in June and September 2021. Six morphological characteristics of 45 Chinese Zoysia germplasm collections were determined as follows: leaf length and leaf width were obtained by randomly measuring the length and middle width of the third fully expanded leaf from the top, respectively. Measurements were repeated 10 times and the average was calculated as the final value for each replicate. Ten healthy stolons were randomly selected and the length and diameter of the fourth section were measured as internode length and stem diameter, respectively. The turf height, which is the natural height of plant growth, was measured using the five-point method[33]. Turf density was determined by counting the number of tillers in a 5 cm × 5 cm wire frame and each plot was counted three times.

    • Genomic DNA was extracted from young Zoysia leaves (0.1 g) using the modified CTAB method[34]. The quality of DNA was verified by 0.8% agarose gel electrophoresis, and the DNA concentration was determined by NanoReady. The DNA of 45 samples was diluted to 50 ng·μL−1 using purified water and stored in the refrigerator at 4 °C or −20 °C for later use.

    • Forty SSR primer pairs from Röder et al.[35] and Tsuruta et al.[36] were used in this study. SSR-PCR and SRAP-PCR was performed in a total volume of 20 μL containing 1 μL genomic DNA, 10 μL of 2 × Mix (Yeasen Biotechnology Co., Ltd., Shanghai, China), 1 μL of 10 μmol·L−1 each PCR primer and 7 μL purified water. SSR-PCR reactions were performed in a Bio-Rad thermal cycler (Bio-Rad Inc., Hercules, CA, USA), DNA amplifications were performed with an initial step at 94 °C for 3 min, followed by 35 cycles of 50 s at 94 °C, 30 s at 55 °C, 1 min at 72 °C, and a 10 min final extension step at 72 °C.

      According to the SRAP primer design method published by Li & Quiros[17], 10 forward primers and five reverse primers were randomly selected. SRAP-PCR reactions were performed with an initial step at 94 °C for 4 min and five cycles of 60 s at 37 °C and 60 min at 72 °C. Then 35 cycles of denaturation at 94 °C for 1 min, annealing at 50 °C for 1 min, and extension at 72 °C for 10 s; and then a final extension at 72 °C for 10 min.

      The amplifications were performed in Applied Biosystems Veriti® thermal cycler. Amplification products were stored at 4 °C before being electrophoresed through 10% non-denatured polyacrylamide gels in 1 × TBE (pH 8.0) buffer running at 120 V constant voltage for 1.5 h and then the gels were stained with fast silver stain[37, 38]. According to the silver staining results, 10 SSR primer pairs and nine SRAP primer pairs were initially screened against 45 Chinese Zoysia germplasm collections (Tables 2 & 3).

      Table 2.  Simple sequence repeats (SSR) primer sequences used for studying genetic diversity of 45 Chinese Zoysia germplasm collections.

      Primer nameForward primer (5'-3')Reverse primer (5'-3')
      M3A10CGAACGCGACATGACAATCTCATGATGTTGGCAACCAC
      Xgwm37-7DACTTCATTGTTGATCTTGCATGCGACGAATTCCCAGCTAAAC
      Xgwm102-2DTCTCCCATCCAACGCCTCTGTTGGTGGCTTGACTATTG
      Xgwm111-7DTCTGTAGGCTCTCTCCGACTGACCTGATCAGATCCCACTCG
      Xgwm120-2BGATCCACCTTCCTCTCTCTCGATTATACTGGTGCCGAAAC
      Xgwm169-6AACCACTGCAGAGAACACATACGGTGCTCTGCTCTAAGTGTGGG
      Xgwm445-2DGTTGAGCTTTTCAGTTCGGCACGGAGAGCAACCTGCC
      Xgwm46-7BGCACGTGAATGGATTGGACTGACCCAATAGTGGTGGTCA
      Xgwm52-3DCTATGAGGCGGAGGTTGAAGTGCGGTGCTCTTCCATTT
      Xgwm234-5BGAGTCCTGATGTGAAGCTGTTGCTCATTGGGGTGTGTACGTG

      Table 3.  Sequence-related amplified polymorphism (SRAP) primer sequences used for studying genetic diversity of 45 Chinese Zoysia germplasm collections.

      Forward primer (5'-3')
      Me1TGAGTCCAAACCGGATA
      Me2TGAGTCCAAACCGGAGC
      Me3TGAGTCCAAACCGGACC
      Me4TGAGTCCAAACCGGACA
      Me5TGAGTCCAAACCGGTGC
      Me6TGAGTCCAAACCGGAGA
      Me7TGAGTCCAAACCGGACG
      Me8TGAGTCCAAACCGGAAA
      Me9TGAGTCCAAACCGGAAC
      Me10TGAGTCCAAACCGGAAT
      Reverse primer (5'-3')
      Em1GACTGCGTACGAATTCAA
      Em2GACTGCGTACGAATTCTG
      Em3GACTGCGTACGAATTGAC
      Em4GACTGCGTACGAATTTGA
      Em5GACTGCGTACGAATTAAC
    • Gel images from all accessions were visually evaluated and coded as either a '1' for the presence or '0' for the absence of a band for each marker. Based on this method, matrices of '0' and '1' were obtained for 45 germplasm collections based on the amplification of each pair of primers. Popgene 3.2 software was used to calculate the number of alleles (Na), effective number of alleles (Ne), Shannon information index (I) and Nei's gene diversity (H). Genetic distances were calculated for the 45 Chinese Zoysia germplasm collections according to Dice[39] using NTSYS-pc. Genetic similarity coefficient (GS) was calculated, and dendrograms was constructed using unweighted pair-group method with arithmetic averages (UPGMA) by the NTSYS-pc computer program package. The confidence probability of the fingerprint was calculated based on the probability formula P = 1/2n, where n is the number of alleles, i.e., the number of polymorphic bands for each primer pair.

    • A total of 395 bands were amplified with 19 pairs of primers, among which 380 were polymorphic bands, with a polymorphism ratio of 96.20% (Table 4). Ten SSR primer combinations amplified a total of 231 polymorphic bands with a polymorphism ratio of 97.18%. The number of bands scored per SSR primer combination ranged from 16 to 36, with a mean of 23.70. A total of 149 polymorphic bands were amplified by nine pairs of SRAP primers, and the polymorphism ratio was 93.43%. The number of bands scored per SRAP primer combination ranged from 13 to 30, with a mean of 17.56. Based on the amplification of SSR and SRAP primers, the effective alleles ranged from 1.192 to 1.556 with an average of 1.332, Shannon information index ranged from 0.236 to 0.510 with an average of 0.350, and Nei's gene diversity index ranged from 0.146 to 0.338, and the mean value is 0.219. The results showed that there was a high level of genetic diversity among the tested germplasm collections, and the SSR and SRAP primers screened were suitable for amplification detection of Zoysia.

      Table 4.  Polymorphism results from amplification by simple sequence repeats (SSR) and sequence-related amplified polymorphism (SRAP) primers in 45 Chinese Zoysia germplasm collections.

      PrimerTotal number of
      amplified bands
      Number of
      polymorphic bands
      Percentage of
      polymorphic bands (%)
      Effective number
      of alleles
      Shannon
      information index
      Nei's diversity
      index
      M3C062727100.001.4430.4260.272
      Xgwm37-7D171694.121.2010.2590.146
      Xgwm102-2D242291.671.3500.3520.224
      Xgwm111-7D2828100.001.2540.2950.172
      Xgwm120-2B363597.221.5560.5100.338
      Xgwm169-6A1616100.001.2760.3330.197
      Xgwm445-2D3232100.001.3960.3980.250
      Xgwm46-7B161593.751.3940.3990.255
      Xgwm52-3D201995.001.4090.4130.262
      Xgwm234-5B2121100.001.2490.3050.179
      SSR marker average23.7023.1097.181.3530.3690.229
      Me3-Em13030100.001.2750.3370.199
      Me2-Em2171694.121.3140.3330.204
      Me3-Em2131292.311.4480.3890.258
      Me4-Em42020100.001.4220.4170.264
      Me6-Em4141392.861.1920.2360.185
      Me5-Em2131184.621.2520.2920.174
      Me3-Em3191789.471.4100.3880.251
      Me6-Em2171694.121.2170.2860.163
      Me7-Em1151493.331.2540.2840.171
      SRAP marker average17.56116.5693.431.3090.3290.208
      Average of all markers20.792096.201.3320.3500.219
      Total395380
    • NTSYS-pc software was used to calculate the value of GS between any two materials according to Dice's coefficient, which was based on the combined amplification results of SSR and SRAP (Table 5). The GS of the 45 germplasm collections ranged from 0.623 to 0.856, with an average value of 0.727 and a variation of 0.233. ZG048 was most genetically similar to ZG053 (GS = 0.856), and ZG025 was most genetically dissimilar to ZG032 (GS = 0.632). Furthermore, two commercial cultivars, Lanyin No. 3 and Qingdao, were found to be highly genetically similar (GS = 0.815). The least genetically similar to Lanyin No. 3 was ZG040 (GS = 0.651), while the least genetically similar to Qingdao was ZG008 (GS = 0.661).

      Table 5.  Genetic similarity coefficients (GS) among the 45 Chinese Zoysia germplasm collections.

      Germplasm IDHighest similarity
      (germplasm ID
      compared to)
      Lowest similarity
      (germplasm ID
      compared to)
      Average
      ZG0030.8532 (ZG004)0.6228 (ZG032)0.738
      ZG0040.8532 (ZG003)0.6582 (ZG032)0.756
      ZG0070.8127 (ZG009)0.6532 (ZG029)0.733
      ZG0080.7772 (ZG015)0.6278 (ZG081)0.703
      ZG0090.8127 (ZG007)0.6633 (ZG081)0.738
      ZG0110.7873 (ZG021)0.6456 (ZG081)0.716
      ZG0130.8152 (ZG021)0.6684 (ZG081)0.742
      ZG0150.7772 (ZG008)0.6608 (ZG060)0.719
      ZG0170.7722 (ZG025)0.6582 (ZG032)0.715
      ZG0180.8101 (ZG021)0.6557 (ZG032)0.733
      ZG0210.8304 (ZG022)0.6658 (ZG046)0.748
      ZG0220.8304 (ZG021)0.6759 (ZG032)0.753
      ZG0230.7848 (ZG026)0.6532 (ZG081)0.719
      ZG0250.7722 (ZG017)0.6228 (ZG032)0.698
      ZG0260.7848 (ZG023)0.6430 (ZG032)0.714
      ZG0280.7772 (ZG021)0.6684 (ZG060)0.723
      ZG0290.7646 (ZG035)0.6506 (ZG081)0.708
      ZG0300.7823 (ZG043)0.6582 (ZG081)0.720
      ZG0320.7418 (ZG037)0.6228 (ZG025)0.682
      ZG0350.8329 (ZG037)0.6684 (ZG081)0.751
      ZG0370.8329 (ZG035)0.6532 (ZG081)0.743
      ZG0380.8304 (ZG037)0.6658 (ZG081)0.748
      ZG0400.7316 (ZG047)0.6456 (ZG003)0.689
      ZG0410.7873 (ZG043)0.6633 (ZG082)0.725
      ZG0430.7873 (ZG041)0.6658 (ZG032)0.727
      ZG0440.7722 (ZG035)0.6481 (ZG082)0.710
      ZG0460.7519 (ZG047)0.6456 (ZG081)0.699
      ZG0470.7899 (ZG048)0.6759 (ZG081)0.733
      ZG0480.8557 (ZG053)0.6633 (ZG081)0.760
      ZG0490.7873 (ZG047)0.6810 (ZG026)0.734
      ZG0500.7595 (ZG058)0.6709 (ZG004)0.715
      ZG0530.8557 (ZG048)0.6684 (ZG032)0.762
      ZG0560.7873 (ZG057)0.6684 (ZG103)0.728
      ZG0570.8051 (ZG059)0.6633 (ZG082)0.734
      ZG0580.7873 (ZG013)0.6532 (ZG082)0.720
      ZG0590.8051 (ZG057)0.6785 (ZG032)0.742
      ZG0600.7646 (ZG049)0.6354 (ZG032)0.700
      ZG0610.8152 (ZG062)0.6506 (ZG025)0.733
      ZG0620.8253 (ZG063)0.6557 (ZG032)0.741
      ZG0630.8253 (ZG062)0.6608 (ZG046)0.743
      ZG0810.7949 (ZG083)0.6278 (ZG032)0.711
      ZG0820.7899 (ZG083)0.6354 (ZG025)0.713
      ZG0830.7949 (ZG081)0.6481 (ZG040)0.722
      Lanyin No. 30.8152 (ZG105)0.6506 (ZG040)0.733
      Qingdao0.8152 (ZG103)0.6608 (ZG008)0.738
    • Based on the results of SSR and SRAP molecular markers, the Dice genetic similarity coefficients were used to cluster 45 Chinese Zoysia germplasm collections. The cophenetic correlation for the UPGMA clustering was high (r = 0.75), suggesting that the cluster analysis strongly represented the similarity matrix. A UPGMA cluster was constructed based on combining data from both markers, which divided the 45 accessions into six major clusters at a similarity index value of 0.71 (Fig. 1). Cluster I contained 32 germplasm collections, comprised of 17 germplasm collections from Anhui, six germplasm collections from Zhejiang, five germplasm collections from Hainan, one material from Liaoning, one radiation mutagenic material and two commercial cultivars. Cluster II comprised of three germplasm collections from Anhui. Cluster III consisted of four accessions, comprising of one from Jiangsu, two from Anhui and one breeding germplasm collections. Cluster IV included two germplasm collections from Zhejiang. Cluster V included only one germplasm from Hainan, ZG046, indicating that ZG046 had some genetic differences from other germplasm collections from the same region. Cluster VI contained three radiation mutagenic materials. Using a genetic similarity coefficient of 0.73, the samples of Cluster I were differentiated into three subgroups: A, B, and C. Subgroup A consisted of Lanyin No. 3, Qingdao, and five germplasm collections from Anhui and Liaoning. Subgroup B contained 10 from Zhejiang and Anhui and one from Hainan (ZG050). Subgroup C included one radiation mutagenic material, nine germplasm collections from Zhejiang and Anhui, and four germplasm collections from Hainan.

      Figure 1. 

      Unweighted pair-group method with arithmetic averages dendrogram of the 45 Chinese Zoysia germplasm collections constructed using simple sequence repeats (SSR) and sequence-related amplified polymorphism (SRAP) markers.

      Cluster I contained most of the germplasm collections and had the most diverse source locations, including four sources, indicating that there was genetic similarity among the germplasm from different sources. For example, ZG003 from Liaoning and ZG004 from Anhui preferentially clustered together and then aggregated with the rest of the germplasm collections in Cluster I. The genetic similarity coefficient of the two germplasm collections was 0.853, which was higher than the average. Aside from Cluster I, the other accessions preferentially clustered together according to their source location, such as Clusters II, IV, and VI.

      In terms of morphological characteristics of the major clusters (Table 6), germplasm collections in subgroup A of Cluster Ⅰ were mainly presented with long and wide leaves, long internodes, large diameter of above ground stems and low density. Germplasm collections of subgroup B was tall and dense, making them suitable for vegetative propagation in ecological restoration or green space construction in parks. Germplasm collections in Subgroup C and Clusters II and III exhibited intermediate morphological characteristics, belonging to the intermediate type germplasm collections. Germplasm collections from Cluster IV (ZG032 and ZG040) were tall with low density which may not be suitable for utilizing as turf. ZG046 was the sole material in Cluster V with short leaves and short internodes, superior traits for sports field turf. Germplasm collections in Cluster VI were mainly characterized by narrow leaves and fine texture, suggesting potential to be used for ornamental lawn in urban green spaces.

      Table 6.  Mean value of main morphological characteristics of the six clusters of 45 Chinese Zoysia germplasm collections.

      Cluster/subgroupLeaf width
      (mm)
      Leaf length
      (cm)
      Internode length
      (cm)
      Stem diameter
      (mm)
      Turf height
      (cm)
      Turf density
      (tiller number cm−2)
      IA4.6610.245.131.5811.444.66
      B3.427.833.591.3510.553.42
      C3.626.754.621.3414.003.62
      II3.707.293.361.2310.082.81
      III3.746.803.821.3711.033.03
      IV3.666.663.721.4122.962.17
      V3.474.153.111.389.072.81
      VI3.276.334.631.378.142.80
      Mean3.727.514.221.3810.833.19
    • The selected SSR and SRAP primers were used to amplify the DNA from 45 Chinese Zoysia germplasm collections, and the results of amplified bands were stable and reproducible. Fewer primers are preferred if they are able to distinguish among varieties. In this study, one SSR primer set (Xgwm234-5B) and two SRAP primer sets (Me3-Em1 and Me3-Em2) were selected to construct SSR and SRAP fingerprints of 45 germplasm collections, respectively, by considering the clarity and percentage of polymorphic of amplified bands for each primer pair (Table 7). The primer pairs Xgwm234-5B, Me3-Em1, and Me3-Em2 amplified 21, 30, and 12 polymorphic bands, respectively. The fingerprint detection probability formula P = 1/2n was used of which n was 21 and 42 for SSR and SRAP fingerprints, respectively. The confidence probability of both SSR and SRAP fingerprints were more than 99.999%. These results indicated that the fingerprint obtained in this study could be used to distinguish among the 45 Chinese Zoysia germplasm collections.

      Table 7.  Fingerprints of 45 Chinese Zoysia germplasm collections generated by simple sequence repeats (SSR) and sequence-related amplified polymorphism (SRAP) markers.

      No.Germplasm IDDigital DNA fingerprint
      SSR (Xgwm234-5B)SRAP (Me3-Em1+Me3-Em2)
      1ZG003111000100010100110000000001000000000001000000011011-0001101010010
      2ZG004000001000010000100000000000100001000001000001010010-0001101010010
      3ZG007100000100010000100100000000100010001000010001001110-0000001100001
      4ZG008001000000010000100111100000000010000000001000001100-0000001110011
      5ZG009101010000010100101100000001000000010100010001001110-0000001110001
      6ZG011100000000010000100010000000000000000001000000000000-1001101010010
      7ZG013000000100010000100000010001000000010001010010010000-0001101010010
      8ZG015001000000010000100001100010001100000000001000000100-0000001000011
      9ZG017000100100010000100101000010001000000000010010001100-0000101100010
      10ZG018000000000000000100001000001000010000000110010110010-1001101010010
      11ZG021101000100010000100000010001000000010001000010110001-0001101010010
      12ZG022100000110010001100000000001000000000000000010100000-0001101010010
      13ZG023000000000010000000000000010000100010001010010100100-1001111010010
      14ZG025000000000010000101100010010001000010000000010001110-0000101100010
      15ZG026001001100011100100110010001101100000001010000100100-1001111010010
      16ZG028000001100010000110000010001000000000010000010101010-0001101010010
      17ZG029001000000010001100100000010000000010000000000100100-1001101010010
      18ZG030001001000111000100011100010100100000001010010100000-1000111010011
      19ZG032000001000010001110000100010000010010001010110100001-0000001010001
      20ZG035001010000010000100010000010001010010000000000100010-1001101010011
      21ZG037000001100010001100000000010001000010000000010100000-1001101010011
      22ZG038000000000010000100000010010000100010000000000010000-1001101010011
      23ZG040000000000010000100100000010010100000000001010010000-0000101010011
      24ZG041010010100010000100000010010000100000001000100100000-0001101010011
      25ZG043000000100011000100000000000000000000000101010100011-0000101010011
      26ZG044011100010010000100000010001001010001000000010100000-1001101011011
      27ZG046000000001000000110010010000100100010000110010001000-0000111110011
      28ZG047000000000000000100010000000000001010000000010101000-0000101110011
      29ZG048001001110010001101010010010000001010001001000001000-0001111110011
      30ZG049100000000010000111110100010000100010100001010001000-0000101110011
      31ZG050000001000010000100011010010000000110001010000000000-1001111010011
      32ZG053001000000011000101010010010000001010001001000001000-0001111110010
      33ZG056000001000010010100010010000001100000000010010001010-0000111110011
      34ZG057001000100010101100010010001000000010010010010001010-0000001110011
      35ZG058001001100010000100110010001000010010000010010001000-1000111010011
      36ZG059010000000010000100010010001000000010000000001001010-0000101110001
      37ZG060000000000010000100110001001000100110000010000001000-0000101110001
      38ZG061000001100010000100000000000100001000000100000000001-1001101010001
      39ZG062100001100010000100101000100100001001000100001010000-0001101010001
      40ZG063000000000011000100100000000100001010000100001010110-0001101010101
      41ZG081010001000010010100110000100000000100100010010101100-0011101010101
      42ZG082001000010010000000110000100010000100100010001100101-0011101010100
      43ZG083000001000010100100110000100000000100100010000101100-0011101010101
      44Lanyin No. 3000000000000100000000000000000000100100000001100001-0001011001001
      45Qingdao110001000010000101000000000000000000100010000101100-1001001010001
      DNA from 45 Chinese Zoysia germplasm collections were amplified with primers Xgwm234-5B, Me3-Em1, and Me3-Em2. The presence or absence of bands in the same location was transformed into the corresponding digital information of 1 or 0, respectively, to form the digital fingerprints.
    • Many Zoysia species, such as Z. sinica, Z. japonica, and Z. matrella, were utilized as turfgrass with relatively substantial genetic diversity. Weng et al.[40] analyzed 131 Zoysia plants collected from Taiwan with random amplified polymorphic DNA (RAPD) and isoenzymes and determined that these germplasms exhibit high genetic variation at the DNA level. Kimball et al.[41] selected 50 pairs of SSR primers to amplify 62 DNA samples from Zoysia cultivars and accessions, and the genetic similarity obtained from their analysis ranged from 0.29 to 0.51. In our study, the genetic similarity coefficient of 45 germplasm collections ranged from 0.623 to 0.856 indicating that the diversity of 45 germplasm collections was lower. The level of genetic diversity and similarity within and between natural populations is determined by the interaction of climate differences and gene flow, with climate being a major driving force for organisms to adapt to the environment and generate heritable mutations[42]. Zoysia has gained popularity and been widely utilized around the world due to its remarkable heat tolerance, cold tolerance, and saline-alkali tolerance, which results in the complex genetic variation of Zoysia plants.

      In this study, the 45 germplasm collections were divided into six clusters by UPGMA. The geographic origin of Cluster I was relatively complex, comprising of germplasm collections from Anhui (17 samples), Zhejiang (six samples), Hainan (five samples), Liaoning (one sample), one radiation mutagenic material, and two commercial cultivars. Notably, the two control cultivars of Lanyin No. 3 and Qingdao are both in subgroup A of cluster I, yet their origins are quite distinct. Lanyin No. 3 was introduced from the United States by Gansu Ecology Institute in 1988, while Qingdao was collected in Jiaozhou Bay, Shandong Province in 1990, and subsequently cultivated and domesticated. Similarly, it has been reported that the Zoysia cultivars Empire, JaMur, and Atlantic were difficult to be differentiated by 40 SSR markers[24]. Numerous warm-season turfgrass cultivars are highly genetically similar despite reported pedigrees or place of collection[43, 44]. Utilizing other types of markers such as single nucleotide polymorphisms (SNPs) or whole genome sequencing of these cultivars might be able to provide additional information to uncover genotypic diversity. Cluster V was comprised of a single ZG046 from Hainan, while the other five (ZG047, ZG048, ZG049, ZG050, and ZG053) from Hainan were placed in Cluster I. Additionally, these five germplasm collections exhibited significant differences from ZG046 in leaf length and leaf width. Results showed that the genetic distance between ZG046 and the other five germplasm collections was significant. Therefore, ZG046 can be used as a parent material to expand the genetic basis of the breeding population and increase the genetic diversity of breeding material, which would be beneficial for further Zoysia breeding improvement.

      In this study, 45 Chinese Zoysia germplasm collections were characterized and analyzed based on their morphological traits and molecular clustering results. The morphological traits of Zoysia were found to be influenced by various factors, such as origin and genetic inheritance, as well as environmental aspects such as adaptability to the planting environment, centralized management of breeders and extensive cultivation, which have led to increased gene exchange among the Zoysia populations[45]. Liu et al.[46] conducted genetic diversity analysis of 42 seashore paspalum (Paspalum vaginatum Sw.) based on morphology and SRAP molecular markers, and the results of the molecular marker clustering showed that germplasms from the same region were more likely to be clustered together, while the morphology clustering showed that the germplasms clustered together often originated from distinct geographical locations.

      DNA fingerprints generated using molecular markers can offer more precise genetic information[47]. Molecular markers have been utilized to construct fingerprints to identify plant varieties, including radish and cucumber[48, 49]. Accurate identification of cultivars is essential for cultivation and breeding[50]. This study demonstrates that both SSR and SRAP are effective methods for constructing fingerprints of Zoysia germplasm. The 21 polymorphic bands amplified by one pair of SSR primer Xgwm234-5B were able to distinguish all 45 germplasm collections, while the SRAP molecular marker required a total of 43 bands amplified by two pairs of primers Me3-Em1 and Me3-Em2 to generate the fingerprints of the 45 germplasm collections. As Zoysia breeding advances, the number of varieties will continue to increase. To ensure the accuracy and reliability of the fingerprint of increasing number of new varieties, additional primers need to be developed, and it is essential to expand the fingerprint database of Zoysia. In this study, 45 Zoysia lines were divided into six clusters based on both SSR and SRAP markers and fingerprints of those plants were constructed. The findings of this study provided a theoretical basis for the subsequent evaluation and identification of Zoysia germplasm as well as new variety development.

      • This research was financially supported by the Fundamental Research Funds for the Central Universities (XUEKEN2022020).

      • The authors declare that they have no conflict of interest.

      • Copyright: © 2023 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (1)  Table (7) References (50)
  • About this article
    Cite this article
    Wang M, Chen Q, Yu J, Liu J, Tate TM, et al. 2023. Genetic diversity analysis and fingerprint construction for 45 Chinese Zoysia germplasm collections. Grass Research 3:10 doi: 10.48130/GR-2023-0010
    Wang M, Chen Q, Yu J, Liu J, Tate TM, et al. 2023. Genetic diversity analysis and fingerprint construction for 45 Chinese Zoysia germplasm collections. Grass Research 3:10 doi: 10.48130/GR-2023-0010

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return