Search
2025 Volume 5
Article Contents
ARTICLE   Open Access    

Development of SSR molecular markers based on the published genome in seashore paspalum

More Information
  • Received: 13 October 2024
    Revised: 14 December 2024
    Accepted: 17 December 2024
    Published online: 27 March 2025
    Grass Research  5 Article number: e010 (2025)  |  Cite this article
  • Seashore paspalum (Paspalum vaginatum Swartz) is a widely utilized turfgrass in subtropical and tropical regions. To assist germplasm evaluation and breeding new varieties, a study was carried out to identify Simple Sequence Repeats (SSR) sites in the seashore paspalum reference genome and develop primers using bioinformatics software. This study revealed a total of 94,748 SSR sites retrieved in the seashore paspalum reference genome. The average length of SSRs is 14.79 bp, and the number of bases in SSRs accounts for 0.22% of the entire genome. The relative abundance of SSRs is 147.17 loci/Mb, and the relative density of SSRs is 2,175.97 bp/Mb. In addition to single-base repeat units, the most common di-base repeat units are AT, AG, and AC. The most common tri-base repeat units are AGG, ACG, and AAG. The most common quad-base repeat unit, penta-base repeat unit, and hexa-base repeat unit are ATAC, AAAAG, and ATATAC, respectively. In the flanking region of the SSR sites in the reference genome, 85,955 pairs of primers were successfully designed, accounting for 90.72% of the SSR sites identified in the entire genome. Fourteen pairs of SSR marker primers were designed for genetic diversity analysis, which amplified 45 polymorphic sites in 33 seashore paspalum accessions. The Ne values ranged from 1.08 to 2.34, the Shannon diversity index I ranged from 0.18 to 1.03, and Nei's index ranged from 0.08 to 0.57. The 33 collections were classified into six categories. The genetic variation among the 33 collections of seashore paspalum is high and polymorphic-rich. The results of this study provide a theoretical foundation for breeding new varieties of seashore paspalum.
  • 加载中
  • [1] Qi P, Eudy D, Schnable JC, Schmutz J, Raymer PL, et al. 2019. High density genetic maps of seashore paspalum using genotyping-by-sequencing and their relationship to the Sorghum Bicolor genome. Scientific Reports 9:12183 doi: 10.1038/s41598-019-48257-3

    CrossRef   Google Scholar

    [2] Gaetani M, Volterrani M, Magni S, Caturegli L, Minelli A, et al. 2017. Seashore paspalum in the Mediterranean transition zone: phenotypic traits of twelve accessions during and after establishment. Italian Journal of Agronomy 12:808 doi: 10.4081/ija.2017.808

    CrossRef   Google Scholar

    [3] Duncan RR. 1997. Environmental compatibility of seashore paspalum (saltwater couch) for golf courses and other recreational uses. II. Management protocols. International Turfgrass Society Research Journal 8:1216−29

    Google Scholar

    [4] Pompeiano A, Di Patrizio E, Volterrani M, Scartazza A, Guglielminetti L. 2016. Growth responses and physiological traits of seashore paspalum subjected to short-term salinity stress and recovery. Agricultural Water Management 163:57−65 doi: 10.1016/j.agwat.2015.09.004

    CrossRef   Google Scholar

    [5] Kopec DM, Walworth JL, Gilbert JJ, Sower GM, Pessarakli M. 2007. 'SeaIsle 2000' paspalum putting surface response to mowing height and nitrogen fertilizer. Agronomy Journal 99:133−40 doi: 10.2134/agronj2005.0226

    CrossRef   Google Scholar

    [6] Liu Y, Cheng F, Wang Q, Hu Y, Wang Z. 2009. Salinity stress responses and tolerance thresholds in four warm-season turfgrasses. Acta Prataculturae Sinica 18:192−99 doi: 10.3321/j.issn:1004-5759.2009.03.027

    CrossRef   Google Scholar

    [7] Zhang L, Li Y, Tao A, Fang P, Qi J. 2015. Development and characterization of 1,906 EST-SSR markers from unigenes in jute (Corchorus spp.). PLoS One 10:e0140861 doi: 10.1371/journal.pone.0140861

    CrossRef   Google Scholar

    [8] Motalebipour EZ, Kafkas S, Khodaeiaminjan M, Çoban N, Gözel H. 2016. Genome survey of pistachio (Pistacia vera L.) by next generation sequencing: development of novel SSR markers and genetic diversity in Pistacia species. BMC Genomics 17:998 doi: 10.1186/s12864-016-3359-x

    CrossRef   Google Scholar

    [9] Jun TH, Michel AP, Mian MR. 2011. Development of soybean aphid genomic SSR markers using next generation sequencing. Genome 54:360−67 doi: 10.1139/g11-002

    CrossRef   Google Scholar

    [10] La Rota M, Kantety RV, Yu JK, Sorrells ME. 2005. Nonrandom distribution and frequencies of genomic and EST-derived microsatellite markers in rice, wheat, and barley. BMC Genomics 6:23 doi: 10.1186/1471-2164-6-23

    CrossRef   Google Scholar

    [11] Saha MC, Mian R, Zwonitzer JC, Chekhovskiy K, Hopkins AA. 2005. An SSR- and AFLP-based genetic linkage map of tall fescue (Festuca arundinacea Schreb.). Theoretical and Applied Genetics 110:323−36 doi: 10.1007/s00122-004-1843-1

    CrossRef   Google Scholar

    [12] Gao L, Tang J, Li H, Jia J. 2003. Analysis of microsatellites in major crops assessed by computational and experimental approaches. Molecular Breeding 12:245−61 doi: 10.1023/A:1026346121217

    CrossRef   Google Scholar

    [13] Gupta PK, Varshney RK. 2000. The development and use of microsatellite markers for genetic analysis and plant breeding with emphasis on bread wheat. Euphytica 113:163−85 doi: 10.1023/A:1003910819967

    CrossRef   Google Scholar

    [14] Pei D, Song S, Kang J, Zhang C, Wang J, et al. 2023. Characterization of simple sequence repeat (SSR) markers mined in whole grape genomes. Genes 14:663 doi: 10.3390/genes14030663

    CrossRef   Google Scholar

    [15] Zhang S, Liang S, Zheng X, Ren H, Zhu T, et al. 2019. Development of genomic SSR and application in Chinese bayberry. Acta Horticulturae Sinica 46:149−56 doi: 10.16420/j.issn.0513-353x.2018-0233

    CrossRef   Google Scholar

    [16] Guo Y, Wu Y, Anderson JA, Moss JQ, Zhu L, et al. 2017. SSR marker development, linkage mapping, and QTL analysis for establishment rate in common bermudagrass. The Plant Genome 10:plantgenome2016.07.0074 doi: 10.3835/plantgenome2016.07.0074

    CrossRef   Google Scholar

    [17] Tanaka H, Hirakawa H, Kosugi S, Nakayama S, Ono A, et al. 2016. Sequencing and comparative analyses of the genomes of zoysiagrasses. DNA Research 23:171−80 doi: 10.1093/dnares/dsw006

    CrossRef   Google Scholar

    [18] Gaire S, Yu X, Milla-Lewis SR. 2024. Molecular advances in St. Augustinegrass: from DNA markers to genome sequencing. Grass Research 4:e021 doi: 10.48130/grares-0024-0017

    CrossRef   Google Scholar

    [19] Harris-Shultz K, Raymer P, Scheffler BE, Arias RS. 2013. Development and characterization of seashore paspalum SSR markers. Crop Science 53:2679−85 doi: 10.2135/cropsci2012.11.0671

    CrossRef   Google Scholar

    [20] Sun G, Wase N, Shu S, Jenkins J, Zhou B, et al. 2022. Genome of Paspalum vaginatum and the role of trehalose mediated autophagy in increasing maize biomass. Nature Communications 13:7731 doi: 10.1038/s41467-022-35507-8

    CrossRef   Google Scholar

    [21] Wu R, Liu L, Ding F, Chen L, Qian G. 2013. The DNA extraction with modified CTAB method and SSR reaction system optimization of Malus hupehensis (Pamp.) Rehd. Genomics and Applied Biology 32:227−31 doi: 10.3969/gab.032.000227

    CrossRef   Google Scholar

    [22] Du L, Zhang C, Liu Q, Zhang X, Yue B. 2018. Krait: an ultrafast tool for genome-wide survey of microsatellites and primer design. Bioinformatics 34:681−83 doi: 10.1093/bioinformatics/btx665

    CrossRef   Google Scholar

    [23] Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, et al. 2020. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Molecular Plant 13:1194−202 doi: 10.1016/j.molp.2020.06.009

    CrossRef   Google Scholar

    [24] Dice LR. 1945. Measures of the amount of ecologic association between species. Ecology 26:297−302 doi: 10.2307/1932409

    CrossRef   Google Scholar

    [25] Ashraf H, Husaini AM, Bhat MA, Parray GA, Khan S, et al. 2016. SSR based genetic diversity of pigmented and aromatic rice (Oryza sativa L.) genotypes of the western Himalayan region of India. Physiology and Molecular Biology of Plants 22:547−55 doi: 10.1007/s12298-016-0377-8

    CrossRef   Google Scholar

    [26] Rafeipour M, Mirzaghaderi G, Shaaf S, Badakhshan H. 2016. SSR assessment of the genetic diversity of emmer wheat with emphasis on Iranian landraces (Triticum dicoccon Schrank). Genetic Resources and Crop Evolution 63:595−600 doi: 10.1007/s10722-016-0379-y

    CrossRef   Google Scholar

    [27] Rassmann K, Schlötterer C, Tautz D. 1991. Isolation of simple-sequence loci for use in polymerase chain reaction-based DNA fingerprinting. Electrophoresis 12:113−18 doi: 10.1002/elps.1150120205

    CrossRef   Google Scholar

    [28] Bharti R, Kumar S, Parekh MJ. 2018. Development of genomic simple sequence repeat (gSSR) markers in cumin and their application in diversity analyses and cross-transferability. Industrial Crops and Products 111:158−64 doi: 10.1016/j.indcrop.2017.10.018

    CrossRef   Google Scholar

    [29] Liu ZW, Jarret RL, Kresovich S, Duncan RR. 1995. Characterization and analysis of simple sequence repeat (SSR) loci in seashore paspalum (Paspalum vaginatum Swartz). Theoretical and Applied Genetics 91:47−52 doi: 10.1007/BF00220857

    CrossRef   Google Scholar

    [30] Jia X, Deng Y, Sun X, Liang L, Ye X. 2015. Characterization of the global transcriptome using Illumina sequencing and novel microsatellite marker information in seashore paspalum. Genes & Genomics 37:77−86 doi: 10.1007/s13258-014-0231-8

    CrossRef   Google Scholar

    [31] Schnable PS, Ware D, Fulton RS, Stein JC, Wei F, et al. 2009. The B73 maize genome: complexity, diversity, and dynamics. Science 326:1112−15 doi: 10.1126/science.1178534

    CrossRef   Google Scholar

    [32] International Wheat Genome Sequencing Consortium (IWGSC). 2014. A chromosome-based draft sequence of the hexaploid bread wheat (Triticum aestivum) genome. Science 345:1251788 doi: 10.1126/science.1251788

    CrossRef   Google Scholar

    [33] Han B, Wang C, Tang Z, Ren Y, Li Y, et al. 2015. Genome-wide analysis of microsatellite markers based on sequenced database in Chinese spring wheat (Triticum aestivum L.). PLoS One 10:e0141540 doi: 10.1371/journal.pone.0141540

    CrossRef   Google Scholar

    [34] Hu Q, Wang H, Jiang B, Zhu H, He X, et al. 2022. Genome wide simple sequence repeats development and their application in genetic diversity analysis in wax gourd (Benincasa hispida). Plant Breeding 141:108−18 doi: 10.1111/pbr.12990

    CrossRef   Google Scholar

    [35] Zhao TM, Zheng SG, Hu YD, Zhao RX, Li HJ, et al. 2019. Classification of interspecific and intraspecific species by genome-wide SSR markers on Dendrobium. South African Journal of Botany 127:136−46 doi: 10.1016/j.sajb.2019.08.051

    CrossRef   Google Scholar

    [36] Zhang R, Wen Q, Xu L. 2019. Development and characterization of genomic SSR markers for Tamarix chinensis (Tamaricaceae). Applications in Plant Sciences 7:e01219 doi: 10.1002/aps3.1219

    CrossRef   Google Scholar

    [37] Li J, Li S, Kong L, Wang L, Wei A, et al. 2020. Genome survey of Zanthoxylum bungeanum and development of genomic-SSR markers in congeneric species. Bioscience Reports 40:BSR20201101 doi: 10.1042/BSR20201101

    CrossRef   Google Scholar

    [38] Sun J, Peng G, Xiong L, Tan C, Li Y, et al. 2021. Genome-wide SSR marker development and application in genetic diversity analysis of the red swamp crayfish, Procambarus clarkii (Girard, 1852) in China. Crustaceana 94:189−205 doi: 10.1163/15685403-bja10076

    CrossRef   Google Scholar

    [39] Powell W, Machray GC, Provan J. 1996. Polymorphism revealed by simple sequence repeats. Trends in Plant Science 1:215−22 doi: 10.1016/1360-1385(96)86898-1

    CrossRef   Google Scholar

  • Cite this article

    Chen Q, Yu J, Wang M, Yang Z. 2025. Development of SSR molecular markers based on the published genome in seashore paspalum. Grass Research 5: e010 doi: 10.48130/grares-0025-0001
    Chen Q, Yu J, Wang M, Yang Z. 2025. Development of SSR molecular markers based on the published genome in seashore paspalum. Grass Research 5: e010 doi: 10.48130/grares-0025-0001

Figures(5)  /  Tables(6)

Article Metrics

Article views(3604) PDF downloads(2316)

Other Articles By Authors

ARTICLE   Open Access    

Development of SSR molecular markers based on the published genome in seashore paspalum

Grass Research  5 Article number: e010  (2025)  |  Cite this article

Abstract: Seashore paspalum (Paspalum vaginatum Swartz) is a widely utilized turfgrass in subtropical and tropical regions. To assist germplasm evaluation and breeding new varieties, a study was carried out to identify Simple Sequence Repeats (SSR) sites in the seashore paspalum reference genome and develop primers using bioinformatics software. This study revealed a total of 94,748 SSR sites retrieved in the seashore paspalum reference genome. The average length of SSRs is 14.79 bp, and the number of bases in SSRs accounts for 0.22% of the entire genome. The relative abundance of SSRs is 147.17 loci/Mb, and the relative density of SSRs is 2,175.97 bp/Mb. In addition to single-base repeat units, the most common di-base repeat units are AT, AG, and AC. The most common tri-base repeat units are AGG, ACG, and AAG. The most common quad-base repeat unit, penta-base repeat unit, and hexa-base repeat unit are ATAC, AAAAG, and ATATAC, respectively. In the flanking region of the SSR sites in the reference genome, 85,955 pairs of primers were successfully designed, accounting for 90.72% of the SSR sites identified in the entire genome. Fourteen pairs of SSR marker primers were designed for genetic diversity analysis, which amplified 45 polymorphic sites in 33 seashore paspalum accessions. The Ne values ranged from 1.08 to 2.34, the Shannon diversity index I ranged from 0.18 to 1.03, and Nei's index ranged from 0.08 to 0.57. The 33 collections were classified into six categories. The genetic variation among the 33 collections of seashore paspalum is high and polymorphic-rich. The results of this study provide a theoretical foundation for breeding new varieties of seashore paspalum.

    • Seashore paspalum (Paspalum vaginatum Swartz) is a perennial grass in the paspalum genus of the Gramineae family, with a chromosome number of 2n = 20[1]. Seashore paspalum produces both rhizomes and stolons, and has a medium to fine texture, good color density, and tolerance to low mowing[2]. It can be used as a turfgrass in sports fields, home lawns, as well as golf courses in subtropical and tropical regions[35]. Seashore paspalum has excellent salt tolerance and can survive well in tidal flats with a salinity level above 470 mmol/L NaCl[6].

      Simple sequence repeats (SSRs), also known as microsatellite DNA, are commonly present in plant genomes. As a type of molecular marker, SSRs have many advantages, such as being scattered in the genome, high abundance, co-dominant inheritance, high polymorphism, and good repeatability[7,8]. SSR molecular markers are widely used in areas involving plant genetic diversity analysis, parent identification, and genetic linkage map development[9].

      There are mainly two methods to develop SSR molecular markers using bioinformatics technology, which are based on expressed sequence tags (Expressed sequence tag, EST) to develop EST-SSR primers (eSSR), and based on genome sequence to develop genome SSR primers (gSSR), respectively[7,9]. Because the eSSR primers are derived from highly conserved DNA transcription regions, the polymorphism revealed by them is theoretically lower than that of gSSR primers. In addition, the sensitivity of eSSR markers in distinguishing closely related genotypes is not as high as gSSR markers. Genomic SSR markers are highly polymorphic and tend to be widely distributed throughout the genome, resulting in better map coverage than eSSR[10,11]. However, the development of gSSR markers is limited but increasing due to the complexity associated with genomic sequencing, especially in polyploid species[12,13]. The development of gSSRs in plants such as soybeans (Glycine max L.), grapes (Vitis vinifera L.), and bayberries (Morella rubra Lour.) has been previously reported[9,14,15], the genomes of some warm-season turfgrasses have also been published, like bermudagrass, zoysiagrass, St. Augustinegrass[1618], but there are fewer gSSR studies of them, and similarly, there are fewer reports on the development of gSSRs in seashore paspalum[19].

      In this study, based on the recently published genome information of seashore paspalum (GCA_026573395.1)[20], bioinformatics tools were used to identify SSR loci, reveal their characteristics, design primers, and evaluate the polymorphism using those primers. The SSR developed in this study may facilitate further research on genetic diversity analysis, genetic linkage mapping, marker-assisted selection, and identification of hybrids in seashore paspalum.

    • Thirty-three germplasm sources of seashore paspalum were planted at the Turfgrass Research Institute of Nanjing Agricultural University in Jurong, Jiangsu Province (China) for molecular marker validation and genetic diversity analysis. The sources of the germplasms are presented in Table 1, and individual plants were planted using sprigs.

      Table 1.  Information of 33 germplasm sources of seashore paspalum.

      No. Germplasm ID Type or cultivar Source
      1 SP001 Seaspray Hainan, China
      2 SP002 Salam Hainan, China
      3 SP004 SeaIsle 2000 Zhejiang, China
      4 SP005 Breeding material Radiation mutagenesis
      5 SP006 Adalayd-2 Guangdong, China
      6 SP019 Mauna key USA
      7 SP022 HI 26 USA
      8 SP035 AM3554 USA
      9 SP036 Temple 1 USA
      10 SP041 Grif 15191 Brazil
      11 SP107 Breeding material USA
      12 SP052 Breeding material Radiation mutagenesis
      13 SP053 Breeding material Radiation mutagenesis
      14 SP061 Breeding material Anhui, China
      15 SP083 Breeding material Hainan, China
      16 SP084 Breeding material Hainan, China
      17 SP089 Breeding material Hainan, China
      18 SP090 Breeding material Hainan, China
      19 SP091 Breeding material Guangxi, China
      20 SP092 Breeding material Guangxi, China
      21 SP093 Breeding material Hainan, China
      22 SP094 Breeding material Guangxi, China
      23 SP095 Breeding material Fujian, China
      24 SP096 Breeding material Anhui, China
      25 SP097 Breeding material Zhejiang, China
      26 SP098 Breeding material Shanghai, China
      27 SP099 Breeding material Fujian, China
      28 SP100 Breeding material Hainan, China
      29 SP102 Breeding material USA
      30 SP103 Breeding material Hainan, China
      31 SP106 Breeding material Jiangsu, China
      32 SP108 Breeding material Hainan, China
      33 SP110 Breeding material Jiangsu, China
    • Leaf samples of actively growing seashore paspalum were collected for DNA extraction using the modified CTAB (Cetyltrimethyl Ammonium Bromide) method[21]. The quality of the DNA was verified by 0.8% agarose gel electrophoresis and the DNA concentration was determined by NanoReady (Hangzhou LifeReal Biotechnology Co., Ltd., Hangzhou, China). The extracted DNA was diluted to a concentration of 50 ng/L and stored at −20 °C.

    • The reference genome sequence of seashore paspalum (GCA_026573395.1) was downloaded from the National Center for Biotechnology Information database (www.ncbi.nlm.nih.gov). The assembled seashore paspalum genome contains 10 chromosomes, 2,211 scaffolds, with a total genome size of 646.9 Mb.

    • The downloaded seashore paspalum genome sequence was imported into the software Krait[22] for SSR site search. The minimum repeat numbers for mono-, di-, tri-, tetra-, penta-, and hexa-nucleotide motifs were set to 10, 6, 5, 5, 5, and 5, respectively. The flanking sequences within 100 bp of the identified SSR sites were used for primer design. The parameters for primer design were set as the default settings in Krait software, with a product size range of 100−400 bp, melting temperature (TM) range of 58−65 °C, a GC content range of 40%−80%, and a primer length range of 18−27 bp.

    • Multiple SSR sites with different types of repeats (excluding mononucleotide repeats) were randomly selected. The designed primers for these SSR sites were screened using the ePCR (electronic PCR) plugin in TBtools software[23]. Primers showing specificity were selected for subsequent synthesis and non-denaturing polyacrylamide gel electrophoresis for specificity and polymorphism detection. Fourteen pairs of specific primers were selected based on ePCR results, and these primers were used for genotypic analysis of the 33 seashore paspalum germplasm accessions. All primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd. (Beijing, China).

      The PCR amplification was performed in a 10-μL reaction, including 1 μL DNA template, 0.5 μL each of upstream and downstream primers, 3 μL of ddH2O, and 5 μL of 2 × PCR Mix (Beijing Tsingke Biotechnology Co., Ltd., Beijing, China). The PCR amplification was performed under the following conditions: initial denaturation at 94 °C for 5 min, followed by 35 cycles of 30 s at 94 °C, 30 s at 60 °C, and 30 s at 72 °C, and a final extension at 72 °C for 10 min. The PCR products were then subjected to a 9% non-denaturing polyacrylamide gel electrophoresis. After electrophoresis, the gel was silver stained and photographed, and the presence or absence of alleles was recorded as 1 or 0 for further primer polymorphism analysis, respectively. Popgene 3.2 software was used to calculate the number of alleles (Na), effective number of alleles (Ne), Shannon information index (I), and Nei's gene diversity (H). Genetic distances were calculated for the 33 seashore paspalum germplasm sources according to Dice[24] using NTSYS-pc. The genetic similarity coefficient (GS) was calculated, and dendrograms were constructed using the unweighted pair-group method with arithmetic averages (UPGMA) by the NTSYS-pc computer software.

    • A published seashore paspalum genome was used for developing SSR markers, which comprised 1,902 assembled sequences (Table 2). The total length of these sequences was 646.89 Mb, with the effective sequences accounting for 643.81 Mb. Additionally, there were 3.09 Mb of unknown bases, and the CG content of the genome sequence was 45.9%.

      Table 2.  Summary of the genomic information of seashore paspalum.

      Item Description Number
      Total number of sequences Counts 1,902
      Total length of sequences A + T + C + G + N (bp) 646,899,508
      Total valid length of sequences A + T + C + G (bp) 643,809,508
      Unkown bases (Ns) in sequences Bp 3,090,000
      Percentage of unkown bases Percentage (%) 0.48
      GC content Not include Ns (%) 45.9

      A total of 94,748 SSRs in the seashore paspalum genome were detected (Table 3). These SSRs spanned a total of 1,400,913 base pairs (bp), with an average length of 14.79 bp per SSR. On average, each sequence contained 50 SSR sites. The number of bases in the SSRs accounted for 0.22% of the entire genome. The relative abundance of SSRs was calculated as 147.17 loci per megabase (Mb), while the relative density of SSRs was 2,175.97 bp per Mb. For more specific information, please refer to Table 3.

      Table 3.  Frequency information of SSRs in the reference genome of seashore paspalum.

      Item Description Number
      Total number of perfect SSRs Counts 94,748
      Total length of perfect SSRs Bp 1,400,913
      The average length of SSRs Total SSR length/total SSR counts (bp) 14.79
      SSRs per sequence Total SSR counts/sequence counts 50
      The percentage of sequence covered by SSRs Total SSR length/total sequence length (%) 0.22
      Relative abundance Total SSRs/total valid length (loci/Mb) 147.17
      Relative density Total SSR length/total valid length (bp/Mb) 2,175.97

      The distribution of detected SSR repeat types is shown in Table 4 and Fig. 1. Among the 94,748 SSR sites detected in the seashore paspalum genome, the number of SSRs with mononucleotide repeats is the highest (53,595), accounting for 56.57% of all SSRs, followed by dinucleotide repeats (22,044), trinucleotide repeats (16,047), tetranucleotide repeats (2,086), and pentanucleotide repeats (579), which account for 23.27%, 16.94%, 2.2%, and 0.61% of the total SSRs in the genome, respectively. The least is hexanucleotide repeats (397), which account for 0.42% of the total SSRs in the genome.

      Table 4.  Description of different types of SSRs in the reference genome of seashore paspalum.

      Type Counts Length (bp) Percent (%) Average length (bp) Relative dbundance (loci/Mb) Relative density (bp/Mb)
      Mono 53,595 621,084 56.57 11.59 83.25 964.7
      Di 22,044 409,090 23.27 18.56 34.24 635.42
      Tri 16,047 282,576 16.94 17.61 24.93 438.91
      Tetra 2,086 55,620 2.2 26.66 3.24 86.39
      Penta 579 16,835 0.61 29.08 0.9 26.15
      Hexa 397 15,708 0.42 39.57 0.62 24.4
      Mono, Di, Tri, Tetra, Penta, and Hexa refer to the types of simple sequence repeats (SSRs) with one, two, three, four, five, and six nucleotide repeats, respectively. The same abbreviations will be used throughout.

      Figure 1. 

      The distribution and quantity information of different repeat types of SSRs in the reference genome of seashore paspalum.

      The types of SSR repeat motifs in the seashore paspalum genome are shown in Fig. 2. The most common repeat motif is A (42,895), accounting for 45.27% of all SSRs in the seashore paspalum genome. The next most common repeat motif is C (10,700), accounting for 11.29%. In addition to mononucleotide repeat motifs, AT (8,801), AG (7,522), and AC (4,203) are the most common in dinucleotide repeats. In trinucleotide repeats, AGG (2,859), ACG (2,306), and AAG (1,588) are the most common. In tetranucleotide repeats, ATAC (353) is the most common. In pentanucleotide repeats, AAAAG (75) is the most common. In hexanucleotide repeats, ATATAC (60) is the most common.

      Figure 2. 

      The most abundant motif categories in the reference genome of seashore paspalum.

      Through the analysis of the annotated files of the seashore paspalum genome, the distribution of SSRs in different regions is shown in Fig. 3. Approximately 86% of SSRs appear in intergenic regions, 7.96% of SSRs occur in exon regions, and 6.07% of SSRs occur in coding sequence (CDS) regions.

      Figure 3. 

      Distribution of perfect SSRs in different region of seashore paspalum reference genome.

    • For the discovered SSRs markers, Krait software successfully designed 85,955 primer pairs in the flanking region of the SSRs site in the seashore paspalum genome, accounting for 90.72% of the SSRs sites mined from the whole genome. The lack of primer coverage on the remaining sites might be due to insufficient flanking sequences or not meeting the appropriate primer design parameter settings. The distribution of seashore paspalum genome SSR primers on different chromosomes is shown in Table 5.

      Table 5.  Distribution of SSR primers in the chromosomes of the seashore paspalum reference genome.

      Chromosome Maker mapped Chromosome Maker mapped
      CM.08 10,591 CM.14 5,991
      CM.09 8,841 CM.15 4,498
      CM.10 8,849 CM.16 6,282
      CM.11 7,670 CM.17 6,635
      CM.12 7,676 All 85,955
      CM.13 6,399
    • Based on the ePCR electronic simulation results of the mined SSR sites and the designed primers, this study designed 60 pairs of gSSR primers. After preliminary screening, 14 pairs of gSSR primers were determined for the genetic diversity analysis of 33 seashore paspalum collections. The results showed that 45 polymorphic loci were amplified at the predicted position by 14 pairs of gSSR primers, with an average of 3.21 loci amplified per pair of primers (Fig. 4). The primer Tm value range and the predicted amplification product information are shown in Table 6.

      Figure 4. 

      Amplification of 33 collections of seashore paspalum with the SSR primers SPR75. M: 500-bp DNA marker; 1−33: SP001−SP110.

      Table 6.  Information of marker and genetic diversity.

      Marker Repeat motif Forward primer Reverse primer Tm (°C) Product size (bp) Na Ne I Nei's
      SPR5 (GGA) 8 GAGAAGGTGACGAGGAGGC TTCAAAAGTTTGCGGACCGG 59 219 2.00 1.98 0.69 0.50
      SPR6 (CT) 9 CGATCGCTTCATGGGAGTGG GCCTAGCTAGCTCTGCATCC 60 188 2.00 1.98 0.69 0.50
      SPR10 (GA) 10 CCTTCGTTCAGTTCAGCTGC GACCAAATTCAAGGCCCACC 59 144 2.00 1.98 0.69 0.50
      SPR11 (TG) 11 TGGGCTAAGCAAGGATGAGG AGTGATGTACAGCTGCTGCC 59 136 2.00 1.50 0.52 0.33
      SPR15 (ATCT) 20 ACCAGAAACTAGCGAGGTAGC AAGATGATCAGCAGTGCCCC 59 187 2.00 1.84 0.65 0.46
      SPR16 (GAG) 11 ACTACACTAATCGGCGGTCG TGGACTTTGGACGTCGTTCC 59 171 2.00 1.50 0.52 0.33
      SPR18 (AT) 26 TCTGTAGTGGTATGCGCACG CACTTTTACAGTTGCGGGGC 60 172 4.00 2.34 1.03 0.57
      SPR26 (AT) 25 GGAGGCACTGTCTAGTATGTGG GCGACTGAATGTTCTGGACC 59 188 2.00 2.00 0.69 0.50
      SPR27 (AT) 28 GGACTGCAGGAACTTTTGAGC CGATCCACTCTCTTTTCTTTCTCC 59 197 3.00 2.06 0.76 0.51
      SPR28 (AGC) 7 GAATGGCGCTTGAGTTGAGC CAGGATCCCCAAGGTGAGC 60 144 2.00 1.35 0.43 0.26
      SPR31 (AAG) 20 ATGCCCGTACTTAGGAAGGC TTAATCCACGGTAGGGGTGC 59 235 2.00 1.46 0.50 0.32
      SPR57 (CGGC) 7 TAACTCGTCGTCGTCTCACG ACTGACGAAGGATGGATGCG 59 135 2.00 1.10 0.18 0.09
      SPR63 (TTAGA) 7 CGTGCTACATGTCCGTGGG TTGCGCTTAATGATGGCTCC 60 135 2.00 1.08 0.17 0.08
      SPR75 (GGAT) 5 CCCATGCGTGCTCAATAACG ACATACACCACACCGTACCG 59 167 2.00 1.13 0.23 0.11
      Average 2.21 1.66 0.55 0.36

      Using Popgene software to analyze the polymorphism of the 14 selected primers, the observed Na ranged from 2 to 4, with an average Na of 2.21; Ne ranged from 1.08 to 2.34, with an average Ne of 1.66; Shannon's genetic diversity index (I) ranged from 0.18 to 1.03, with an average I value of 0.55; Nei's genetic diversity index ranged from 0.08 to 0.57, with an average value of 0.36.

    • According to the UPGMA clustering results of the above 14 pairs of SSR primers on 33 collections (Fig. 5), 33 collections were divided into six categories (I, II, III, IV, V, and VI) at a genetic similarity coefficient of 0.71. Among them, categories II, V, and VI only contained a single material, which were SP083, SP096, and SP102, respectively. Category III included five collections, which were SP052, SP053, SP061, SP098, and SP097. Category IV contained two collections, which were SP95 and SP099, and the other 23 collections were classified as category I.

      Figure 5. 

      UMPGA genetic clustering of 33 collections of seashore paspalum based on SSR molecular markers.

    • SSR molecular markers can be used for plant genetic diversity analysis, construction of plant DNA fingerprinting maps, etc.[25,26]. There are various approaches to developing SSR molecular markers, including constructing gene libraries[27], and developing SSR markers through bioinformatics databases[28], etc. Liu et al.[29] used the method of constructing a gene library to develop SSR molecular markers in seashore paspalum, discovering 54 positive clones out of 13,000 clones. Jia et al.[30] successfully excavated 3,010 potential SSR molecular markers in seashore paspalum using transcriptome sequencing technology. With the rapid development of sequencing technology, the genomic information of several plants has been improved[3133]. Genomic sequence information can be used to develop SSR molecular markers, and the number of SSR molecular markers that can be obtained will be much higher than other methods[34].

      Based on the recently published seashore paspalum reference genome information, this study carried out SSR loci mining and primer design and validation analysis. A total of 94,748 SSRs were detected (Table 3), which greatly increased the number compared to the EST-SSR number (11,568) mined by Jia et al.[30] in the 'Adalady' transcriptome of seashore paspalum. This study and their research summary on SSR mining standards are consistent, indicating that more comprehensive SSR information can be obtained by mining the seashore paspalum genome for SSR.

      In the seashore paspalum reference genome, excluding mononucleotide repeats, dinucleotide and trinucleotide repeats accounted for the most, making up 23.27% and 16.94% of the total 94,748 (Table 4), respectively, which is consistent with previous studies[3538] on the SSR genome analysis results of various plants. Although mononucleotide repeat SSRs are the most abundant and widely distributed in the genome, they are difficult to analyze after PCR amplification and electrophoresis detection. Therefore, mononucleotide repeats are rarely used as utilizable SSR markers. The most common dinucleotide repeat SSR is the AT repeat, with 8,801 occurrences, accounting for about 40% of the dinucleotide repeat type (Fig. 2), which is consistent with the finding of Powell et al.[39].

      Through the analysis of the reference genome, the results show that the most number of SSRs in the seashore paspalum genome occurs in the gene interval area, accounting for as much as 86% of the SSRs, indicating that SSRs are often present in the non-coding regions of genes (Fig. 3). In addition, only 6.07% of SSRs appear in the gene coding area (Fig. 3), and the degree of polymorphism of SSR markers in the gene coding area has a greater impact on the phenotyping of plants. Therefore, the development of SSRs located in the gene coding area also has a greater impetus for plant breeding work. In this study, 14 pairs of SSR primers were utilized to analyze the genetic diversity of 33 seashore paspalum collections, in which, the observed Na ranged from 2 to 4 and Ne ranged from 1.08 to 2.34 (Table 6). The lower values of Na and Ne might be due to the close genetic backgrounds of the 33 seashore paspalum collections, indicating by results that 23 of these collections were classified into cluster I according to the cluster analysis (Fig. 5). In future studies, the agronomic traits of the 33 seashore paspalum collections would be added to investigate whether these SSR markers are associated with agronomic traits. This study designed primers for the SSR loci mined from the seashore paspalum reference genome. Primers were successfully developed from over 90% of the SSR loci (Table 5), indicating that the software used in this experiment could batch design primers for the corresponding loci of the genome, and the loci mined could be used in the subsequent SSR marker development.

    • This research used bioinformatics software including Krait and TBtools to mine SSR information from the reference genome of seashore paspalum. The distribution and quantity information of SSR sites were comprehensively obtained from the reference genome. In addition, 14 new SSR markers were successfully developed. The newly developed primers supplemented the SSR markers of seashore paspalum. In future research, these new SSR markers can be used for the genetic diversity analysis of seashore paspalum germplasm resources. Primer development methods and these primers can also be utilized for kinship analysis, molecular marker-assisted breeding, the construction of genetic linkage maps, and the localization of important traits. This approach will provide molecular technological support for breeding the new varieties in seashore paspalum.

      • This research was financially supported by the Breeding of New Varieties Evergreen Grass in Yangtze River Delta (ZA32303) and the Forestry Science and Technology Promotion Demonstration Funding Program of China (Su [2023] TG12).

      • The authors confirm contribution to the paper as follows: study conception and design: Yang Z; funding acquisition: Yang Z, Yu J; data collection: Chen Q, Yu J; analysis and interpretation of results: Chen Q, Yu J, Wang M; draft manuscript preparation: Chen Q, Yu J. All authors reviewed the results and approved the final version of the manuscript.

      • The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

      • The authors declare that they have no conflict of interest.

      • Copyright: © 2025 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (5)  Table (6) References (39)
  • About this article
    Cite this article
    Chen Q, Yu J, Wang M, Yang Z. 2025. Development of SSR molecular markers based on the published genome in seashore paspalum. Grass Research 5: e010 doi: 10.48130/grares-0025-0001
    Chen Q, Yu J, Wang M, Yang Z. 2025. Development of SSR molecular markers based on the published genome in seashore paspalum. Grass Research 5: e010 doi: 10.48130/grares-0025-0001

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return