Search
2025 Volume 5
Article Contents
ARTICLE   Open Access    

Iron (II)-EDTA alleviate salinity injury through regulating ion balance in halophyte seashore paspalum

More Information
  • Received: 29 October 2024
    Revised: 19 December 2024
    Accepted: 23 December 2024
    Published online: 10 January 2025
    Grass Research  5 Article number: e002 (2025)  |  Cite this article
  • Salt stress is one of the most important abiotic stresses that limits plant growth and development. In high salinity environments, plants adapt to stress mainly by changing their appearance and cell physiological metabolism. Iron is an important trace element in plant growth and development. It is not only an important factor affecting plant photosynthesis but also an ion to maintain plant homeostasis. To ensure the efficient utilization of iron nutrition, Fe (II) EDTA is usually used in iron supplementation of plants. In this study, the aim was to investigate the effects of excessive iron (Fe (II) EDTA) on physiological responses and expression levels of salt-tolerance-related genes in seashore paspalum under salt stress. The results showed that the salt toxicity could be alleviated by applying appropriate excess Fe (II) EDTA under salt stress. Plant biomass, chlorophyll content, net photosynthetic rate (Pn), photochemical efficiency (Fv/Fm), and root activity were improved by excess Fe (II) EDTA under salt stress. High concentration Fe (II) EDTA significantly reduced Na+ content, increased K+/ Na+, and significantly increased Ca2+, Mg2+, Mn2+, and Fe2+ contents in seashore pasplum roots under salt stress. The expression levels of salt-tolerance related genes (PvSOS1, PvCIPK24, PvCBL4 (Na+/H+ transporter), PvHKT1 (K+ transporter), PvPHA, and PvVHA (proton pump) were significantly increased by excess Fe (II) EDTA under salt stress. Therefore, the results of this study suggested that excess Fe (II) EDTA treatment can effectively enhance salt tolerance of seashore paspalum by maintaining ion balance.
  • 加载中
  • [1] Katerji N, Van Hoorn JW, Hamdy A, Mastrorilli M. 2003. Salinity effect on crop development and yield, analysis of salt tolerance according to several classification methods. Agricultural Water Management 62:37−66 doi: 10.1016/S0378-3774(03)00005-2

    CrossRef   Google Scholar

    [2] Yu Z, Duan X, Luo L, Dai S, Ding Z, et al. 2020. How plant hormones mediate salt stress responses. Trends in Plant Science 25:1117−30 doi: 10.1016/j.tplants.2020.06.008

    CrossRef   Google Scholar

    [3] Deinlein U, Stephan AB, Horie T, Luo W, Xu G, et al. 2014. Plant salt-tolerance mechanisms. Trends in Plant Science 19:371−79 doi: 10.1016/j.tplants.2014.02.001

    CrossRef   Google Scholar

    [4] Cheng J, Yan J, Zhang T, Liu J, Guo H. 2008. Growth responses of four warm season turfgrasses to long-term salt stress. Acta Prataculturae Sinica 17:30−36 doi: 10.3321/j.issn:1004-5759.2008.05.005

    CrossRef   Google Scholar

    [5] Fan R, Zhou Q, Zhou B, Jiang H. 2012. Effects of salinization stress on growth and the antioxidant system of tall fescue. Acta Prataculturae Sinica 21:112−17

    Google Scholar

    [6] Wu X, Guo Z, Chen S, Zhuang L. 2019. Advances in research on the tolerance of seashore paspalum (Paspalums vaginatium). Acta Agrestia Sinica 27:1117−25 doi: 10.11733/j.issn.1007-0435.2019.05.002

    CrossRef   Google Scholar

    [7] Silveira JAG, Júnior JM, Silva EN, Ferreira-Silva SL, Aragão RM, et al. 2012. Salt resistance in two cashew species is associated with accumulation of organic and inorganic solutes. Acta Physiologiae Plantarum 34:1629−37 doi: 10.1007/s11738-012-0957-3

    CrossRef   Google Scholar

    [8] Wang Q, Liu Q, Gao Y, Liu X. 2017. Review on the mechanisms of the response to salinity-alkalinity stress in plants. Acta Ecologiea Sinica 37:5565−77

    Google Scholar

    [9] Ku YS, Sintaha M, Cheung MY, Lam HM. 2018. Plant hormone signaling crosstalks between biotic and abiotic stress responses. International Journal of Molecular Sciences 19:3206 doi: 10.3390/ijms19103206

    CrossRef   Google Scholar

    [10] Ali A, Maggio A, Bressan RA, Yun DJ. 2019. Role and functional differences of HKT1-type transporters in plants under salt stress. International Journal of Molecular Sciences 20:1059 doi: 10.3390/ijms20051059

    CrossRef   Google Scholar

    [11] Zhu JK. 2016. Abiotic stress signaling and responses in plants. Cell 167:313−24 doi: 10.1016/j.cell.2016.08.029

    CrossRef   Google Scholar

    [12] Heidari M, Sarani S. 2012. Growth, biochemical components and ion content of Chamomile (Matricaria chamomilla L.) under salinity stress and iron deficiency. Journal of the Saudi Society of Agricultural Sciences 11:37−42 doi: 10.1016/j.jssas.2011.05.002

    CrossRef   Google Scholar

    [13] Chen W, Zhao L, Liu L, Li X, Li Y, et al. 2021. Iron deficiency-induced transcription factors bHLH38/100/101 negatively modulate flowering time in Arabidopsis thaliana. Plant Science 308:110929 doi: 10.1016/j.plantsci.2021.110929

    CrossRef   Google Scholar

    [14] Bloem E, Haneklaus S, Haensch R, Schnug E. 2017. EDTA application on agricultural soils affects microelement uptake of plants. Science of The Total Environment 577:166−73 doi: 10.1016/j.scitotenv.2016.10.153

    CrossRef   Google Scholar

    [15] Briat JF, Dubos C, Gaymard F. 2015. Iron nutrition, biomass production, and plant product quality. Trends in Plant Science 20:33−40 doi: 10.1016/j.tplants.2014.07.005

    CrossRef   Google Scholar

    [16] Halliwell B, Gutteridge JMC. 1992. Biologically relevant metal ion-dependent hydroxyl radical generation an update. FEBS Letters 307:108−12 doi: 10.1016/0014-5793(92)80911-y

    CrossRef   Google Scholar

    [17] Kim SA, LaCroix IS, Gerber SA, Guerinot ML. 2019. The iron deficiency response in Arabidopsis thaliana requires the phosphorylated transcription factor URI. Proceedings of the National Academy of Sciences of the United States of America 116:24933−42 doi: 10.1073/pnas.1916892116

    CrossRef   Google Scholar

    [18] Zhao S, Zhang Q, Liu M, Zhou H, Ma C, et al. 2021. Regulation of plant responses to salt stress. International Journal of Molecular Sciences 22:4609 doi: 10.3390/ijms22094609

    CrossRef   Google Scholar

    [19] Rabhi M, Barhoumi Z, Ksouri R, Abdelly C, Gharsalli M. 2007. Interactive effects of salinity and iron deficiency in Medicago ciliaris. Comptes Rendus Biologies 330:779−88 doi: 10.1016/j.crvi.2007.08.007

    CrossRef   Google Scholar

    [20] Wu D, Shen Q, Cai S, Chen ZH, Dai F, et al. 2013. Ionomic responses and correlations between elements and metabolites under salt stress in wild and cultivated barley. Plant and Cell Physiology 54:1976−88 doi: 10.1093/pcp/pct134

    CrossRef   Google Scholar

    [21] Tripathi DK, Singh S, Gaur S, Singh S, Yadav V, et al. 2017. Acquisition and homeostasis of iron in higher plants and their probable role in abiotic stress tolerance. Frontiers in Environmental Science 5:86 doi: 10.3389/fenvs.2017.00086

    CrossRef   Google Scholar

    [22] Scandalios JG. 1990. Response of plant antioxidant defense genes to environmental stress. Advances in Genetics 28:1−41 doi: 10.1016/s0065-2660(08)60522-2

    CrossRef   Google Scholar

    [23] Sharma P, Jha AB, Dubey RS, Pessarakli M. 2012. Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. Journal of Botany 2012:217037 doi: 10.1155/2012/217037

    CrossRef   Google Scholar

    [24] Ghasemi S, Khoshgoftarmanesh AH, Afyuni M, Hadadzadeh H. 2014. Iron (II) -amino acid chelates alleviate salt-stress induced oxidative damages on tomato grown in nutrient solution culture. Scientia Horticulturae 165:91−98 doi: 10.1016/j.scienta.2013.10.037

    CrossRef   Google Scholar

    [25] Hoagland DR, Arnon DI. 1950. The water culture method for growing plants without soil. The College of Agriculture University of California, Barkeley. pp. 1−32
    [26] Hiscox JD, Israelstam GF. 1979. A method for the extraction of chlorophyll from leaf tissue without maceration using dimethyl sulfoxide. Canadian Journal of Botany 57:1332−34 doi: 10.1139/b79-163

    CrossRef   Google Scholar

    [27] Blum A, Ebercon A. 1981. Cell membrane stability as a measure of drought and heat tolerance in wheat. Crop Science 21:43−47 doi: 10.2135/cropsci1981.0011183X002100010013x

    CrossRef   Google Scholar

    [28] Clemensson-Lindell A, Persson H. 1995. Fine-root vitality in a norway spruce stand subjected to various nutrient supplies. Plant and Soil 168:167−72 doi: 10.1007/BF00029325

    CrossRef   Google Scholar

    [29] Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCᴛ method. Methods 25:402−08 doi: 10.1006/meth.2001.1262

    CrossRef   Google Scholar

    [30] Shen Z, Liu Y, Chen H. 1998. Effects of chelators EDTA and DTPA on the uptake of zinc, copper, manganese and iron by hyperaccumulator Thlaspi caerulescens. Acta Phytophysiologica Sinica 24:340−46

    Google Scholar

    [31] Chen P, Yan K, Shao H, Zhao S. 2013. Physiological mechanisms for high salt tolerance in wild soybean (Glycine soja) from Yellow River Delta, China: photosynthesis, osmotic regulation, ion flux and antioxidant capacity. PLoS One 8:e83227 doi: 10.1371/journal.pone.0083227

    CrossRef   Google Scholar

    [32] Hakim MA, Juraimi AS, Hanafi MM, Ismail MR, Rafil MY, et al. 2014. The effect of salinity on chlorophyll, proline and mineral nutrients in common weeds of coastal rice fields in Malaysia. Journal of Environmental Biology 35:855−64

    Google Scholar

    [33] Parida AK, Das AB. 2005. Salt tolerance and salinity effects on plants: a review. Ecotoxicology and Environmental Safety 60:324−49 doi: 10.1016/j.ecoenv.2004.06.010

    CrossRef   Google Scholar

    [34] Zahra N, Al Hinai MS, Hafeez MB, Rehman A, Wahid A, et al. 2022. Regulation of photosynthesis under salt stress and associated tolerance mechanisms. Plant Physiology and Biochemistry 178:55−69 doi: 10.1016/j.plaphy.2022.03.003

    CrossRef   Google Scholar

    [35] Yan H, Hu X, Li F. 2012. Leaf photosynthesis, chlorophyll fluorescence, ion content and free amino acids in Caragana korshinskii Kom exposed to NaCl stress. Acta Physiologiae Plantarum 34:2285−95 doi: 10.1007/s11738-012-1029-4

    CrossRef   Google Scholar

    [36] Zhao R, An L, Song D, Li M, Qiao L, et al. 2021. Detection of chlorophyll fluorescence parameters of potato leaves based on continuous wavelet transform and spectral analysis. Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 259:119768 doi: 10.1016/j.saa.2021.119768

    CrossRef   Google Scholar

    [37] Liu Z, Zhang H, Yang L, Liu T, Di W. 2014. Growth, and cationic absorption, transportation and allocation of Elaeagnus angustifolia seedlings under NaCl stress. Acta Ecologica Sinica 34:326−36 doi: 10.5846/stxb201303270530

    CrossRef   Google Scholar

    [38] Cheng T, Li H, Wu H, Liu Z, Wu X, et al. 2015. Comparison on osmotica accumulation of different salt-tolerant plants under salt stress. Forest Research 28:826−32 doi: 10.3969/j.issn.1001-1498.2015.06.010

    CrossRef   Google Scholar

    [39] Knight H, Trewavas AJ, Knight MR. 1997. Calcium signalling in Arabidopsis thaliana responding to drought and salinity. The Plant Journal 12:1067−78 doi: 10.1046/j.1365-313x

    CrossRef   Google Scholar

    [40] Stephan AB, Schroeder JI. 2014. Plant salt stress status is transmitted systemically via propagating calcium waves. Proceedings of the National Academy of Sciences of the United States of America 111:6126−27 doi: 10.1073/pnas.1404895111

    CrossRef   Google Scholar

    [41] Choi WG, Toyota M, Kim SH, Hilleary R, Gilroy S. 2014. Salt stress-induced Ca2+ waves are associated with rapid, long-distance root-to-shoot signaling in plants. Proceedings of the National Academy of Sciences of the United States of America 111:6497−502 doi: 10.1073/pnas.1319955111

    CrossRef   Google Scholar

    [42] Chen ZC, Peng WT, Li J, Liao H. 2018. Functional dissection and transport mechanism of magnesium in plants. Seminars in Cell & Developmental Biology 74:142−52 doi: 10.1016/j.semcdb.2017.08.005

    CrossRef   Google Scholar

    [43] Li J, Jia Y, Dong R, Huang R, Liu P, et al. 2019. Advances in the mechanisms of plant tolerance to manganese toxicity. International Journal of Molecular Sciences 20:5096 doi: 10.3390/ijms20205096

    CrossRef   Google Scholar

    [44] He J, Rössner N, Hoang MTT, Alejandro S, Peiter E. 2021. Transport, functions, and interaction of calcium and manganese in plant organellar compartments. Plant Physiology 187:1940−72 doi: 10.1093/plphys/kiab122

    CrossRef   Google Scholar

    [45] Park HJ, Kim WY, Yun DJ. 2016. A New insight of salt stress signaling in plant. Molecules and Cells 39:447−59 doi: 10.14348/molcells.2016.0083

    CrossRef   Google Scholar

    [46] Mansour MMF. 2014. The plasma membrane transport systems and adaptation to salinity. Journal of Plant Physiology 171:1787−800 doi: 10.1016/j.jplph.2014.08.016

    CrossRef   Google Scholar

    [47] Hasegawa PM. 2013. Sodium (Na+) homeostasis and salt tolerance of plants. Environmental and Experimental Botany 92:19−31 doi: 10.1016/j.envexpbot.2013.03.001

    CrossRef   Google Scholar

    [48] Maathuis FJ, Ahmad I, Patishtan J. 2014. Regulation of Na+ fluxes in plants. Frontiers in Plant Science 5:467 doi: 10.3389/fpls.2014.00467

    CrossRef   Google Scholar

    [49] Bassil E, Zhang S, Gong H, Tajima H, Blumwald E. 2019. Cation specificity of vacuolar NHX-type cation/H+ antiporters. Plant Physiology 179:616−29 doi: 10.1104/pp.18.01103

    CrossRef   Google Scholar

    [50] Dutta D, Esmaili M, Overduin M, Fliegel L. 2020. Expression and detergent free purification and reconstitution of the plant plasma membrane Na+/H+ antiporter SOS1 overexpressed in Pichia pastoris. Biochimica et Biophysica Acta (BBA) - Biomembranes 1862:183111 doi: 10.1016/j.bbamem.2019.183111

    CrossRef   Google Scholar

    [51] Martínez-Atienza J, Jiang X, Garciadeblas B, Mendoza I, Zhu JK, et al. 2007. Conservation of the salt overly sensitive pathway in rice. Plant Physiology 143:1001−12 doi: 10.1104/pp.106.092635

    CrossRef   Google Scholar

    [52] Cho JH, Sim SC, Kim KN. 2021. Calcium sensor SlCBL4 associates with SlCIPK24 protein kinase and mediates salt tolerance in Solanum lycopersicum. Plants 10:2173 doi: 10.3390/plants10102173

    CrossRef   Google Scholar

    [53] Sondergaard TE, Schulz A, Palmgren MG. 2004. Energization of transport processes in plants. roles of the plasma membrane H+-ATPase. Plant Physiology 136:2475−82 doi: 10.1104/pp.104.048231

    CrossRef   Google Scholar

    [54] Elkahoui S, Carvajal M, Ghrir R, Limam F. 2005. Study of the involvement of osmotic adjustment and H+-ATPase activity in the resistance of Catharanthus roseus suspension cells to salt stress. Plant Cell, Tissue and Organ Culture 80:287−94 doi: 10.1007/s11240-004-1085-6

    CrossRef   Google Scholar

    [55] Zhang M, Chen Q, Zhou P, Zhang Q, Fang Y. 2018. NaCl-induced changes in vacuolar H+-ATPase expression and vacuolar membrane lipid composition of two shrub willow clones differing in their response to salinity. Plant Growth Regulation 86:445−53 doi: 10.1007/s10725-018-0442-0

    CrossRef   Google Scholar

    [56] Ravari HH, Kavousi HR, Mohammadi F, Pourseyedi S. 2020. Partial cloning, characterization, and analysis of expression and activity of plasma membrane H+-ATPase in kallar grass [Leptochloa fusca (L.) Kunth] under salt stress. Biologia Futura 71:231−40 doi: 10.1007/s42977-020-00019-3

    CrossRef   Google Scholar

    [57] Ponce-Pineda IG, Carmona-Salazar L, Saucedo-García M, Cano-Ramírez D, Morales-Cedillo F, et al. 2021. MPK6 kinase regulates plasma membrane H+-ATPase activity in cold acclimation. International Journal of Molecular Sciences 22:6338 doi: 10.3390/ijms22126338

    CrossRef   Google Scholar

    [58] Horie T, Brodsky DE, Costa A, Kaneko T, Lo Schiavo F, et al. 2011. K+ transport by the OsHKT2;4 transporter from rice with atypical Na+ transport properties and competition in permeation of K+ over Mg2+ and Ca2+ ions. Plant Physiology 156:1493−507 doi: 10.1104/pp.110.168047

    CrossRef   Google Scholar

    [59] Riedelsberger J, Miller JK, Valdebenito-Maturana B, Piñeros MA, González W, et al. 2021. Plant HKT channels: an updated view on structure, function and gene regulation. International Journal of Molecular Sciences 22:1892 doi: 10.3390/ijms22041892

    CrossRef   Google Scholar

    [60] Rubio F, Gassmann W, Schroeder JI. 1995. Sodium-driven potassium uptake by the plant potassium transporter HKT1 and mutations conferring salt tolerance. Science 270:1660−63 doi: 10.1126/science.270.5242.1660

    CrossRef   Google Scholar

    [61] Kronzucker HJ, Britto DT. 2011. Sodium transport in plants: a critical review. New Phytologist 189:54−81 doi: 10.1111/j.1469-8137.2010.03540.x

    CrossRef   Google Scholar

    [62] Davenport RJ, Muñoz-Mayor A, Jha D, Essah PA, Rus A, et al. 2007. The Na+ transporter AtHKT1;1 controls retrieval of Na+ from the xylem in Arabidopsis. Plant, Cell & Environment 30:497−507 doi: 10.1111/j.1365-3040.2007.01637.x

    CrossRef   Google Scholar

    [63] Sunarpi, Horie T, Motoda J, Kubo M, Yang H, et al. 2005. Enhanced salt tolerance mediated by AtHKT1 transporter-induced Na+ unloading from xylem vessels to xylem parenchyma cells. The Plant Journal 44:928−38 doi: 10.1111/j.1365-313X.2005.02595.x

    CrossRef   Google Scholar

    [64] Berthomieu P, Conéjéro G, Nublat A, Brackenbury WJ, Lambert C, et al. 2003. Functional analysis of AtHKT1 in Arabidopsis shows that Na+ recirculation by the phloem is crucial for salt tolerance. The EMBO Journal 22:2004−14 doi: 10.1093/emboj/cdg207

    CrossRef   Google Scholar

  • Cite this article

    Zheng Y, Li Z, Tan Z, Liu Y, Zhang X, et al. 2025. Iron (II)-EDTA alleviate salinity injury through regulating ion balance in halophyte seashore paspalum. Grass Research 5: e002 doi: 10.48130/grares-0024-0029
    Zheng Y, Li Z, Tan Z, Liu Y, Zhang X, et al. 2025. Iron (II)-EDTA alleviate salinity injury through regulating ion balance in halophyte seashore paspalum. Grass Research 5: e002 doi: 10.48130/grares-0024-0029

Figures(4)  /  Tables(2)

Article Metrics

Article views(5683) PDF downloads(1357)

ARTICLE   Open Access    

Iron (II)-EDTA alleviate salinity injury through regulating ion balance in halophyte seashore paspalum

Grass Research  5 Article number: e002  (2025)  |  Cite this article

Abstract: Salt stress is one of the most important abiotic stresses that limits plant growth and development. In high salinity environments, plants adapt to stress mainly by changing their appearance and cell physiological metabolism. Iron is an important trace element in plant growth and development. It is not only an important factor affecting plant photosynthesis but also an ion to maintain plant homeostasis. To ensure the efficient utilization of iron nutrition, Fe (II) EDTA is usually used in iron supplementation of plants. In this study, the aim was to investigate the effects of excessive iron (Fe (II) EDTA) on physiological responses and expression levels of salt-tolerance-related genes in seashore paspalum under salt stress. The results showed that the salt toxicity could be alleviated by applying appropriate excess Fe (II) EDTA under salt stress. Plant biomass, chlorophyll content, net photosynthetic rate (Pn), photochemical efficiency (Fv/Fm), and root activity were improved by excess Fe (II) EDTA under salt stress. High concentration Fe (II) EDTA significantly reduced Na+ content, increased K+/ Na+, and significantly increased Ca2+, Mg2+, Mn2+, and Fe2+ contents in seashore pasplum roots under salt stress. The expression levels of salt-tolerance related genes (PvSOS1, PvCIPK24, PvCBL4 (Na+/H+ transporter), PvHKT1 (K+ transporter), PvPHA, and PvVHA (proton pump) were significantly increased by excess Fe (II) EDTA under salt stress. Therefore, the results of this study suggested that excess Fe (II) EDTA treatment can effectively enhance salt tolerance of seashore paspalum by maintaining ion balance.

    • Salt stress is one of the important abiotic stresses that restricts plant growth and development[1,2]. The symptoms of salt damage to plants are mainly manifested in leaves, such as changes in leaf color, brown-yellow necrosis at the leaf edge, and leaves becoming fleshy[3]. Long-time salt stress inhibited the growth of turfgrass. It significantly inhibited leaf weight, branch dry weight, and branch length of turfgrass, increasing dry weight ratio of underground and aboveground biomass[4]. Salt stress inhibited the growth and biomass of tall fescue (Festuca arundinacea) and seashore paspalum (Paspalum vaginatum)[5,6].

      Plants have developed a series of adapting mechanisms to survive under salt stress. Under high salinity treatment, plants active the synthesis or accumulate organic (pro-line, soluble sugar, betaine, and glycerol, etc.) or inorganic substances (Na+, K+, Cl, Ca2+, SO42−, Mg2+, and NO3, etc.) in cells to enhance the dehydration tolerance and regulate the osmotic stress[7]. Plants can also activate their antioxidant system and the synthesis of stress-related hormone (abscisic acid) response to salt stress[8,9]. Under salt stress, plants have to modulate Na+/K+ homeostasis. High-affinity potassium transporter, HKT1, provides Na+ exclusion and maintains a high K+/Na+ ratio in leaves during salinity stress[10]. The SOS pathway also maintains the Na+ homeostasis and transports excess Na+ from the cytosol to the apoplast to prevent the accumulation of Na+ to toxic levels[11].

      Iron (Fe), one of the nutrient microelements, is essential to plant growth and development, it is involved in many physiological and biochemical reactions in living organisms[12,13]. Iron not only plays an irreplaceable role in photosynthesis, cellular respiration, and electron transport but also participates in plant growth and stress response[13]. To ensure the efficient utilization of iron nutrition, chelated iron (such as Fe-EDTA) is widely used in agricultural production based on its ease of solubility and stability[14]. Iron deficiency will affect the growth and development of plants, and will cause significant economic losses[15]. However, it is also suggested that excess iron is toxic to plants[16]. Thus, regulating ions homeostasis to avoid both iron deficiency and toxicity is crucial for plants[17].

      Salt stress causes osmotic stress in plants, and the homeostasis of ions in cells is destroyed. High concentrations of salt ions reduce the absorption of other nutrient ions, leading to the imbalance of nutrient elements, cell metabolism disorder, and death[3,18]. Excessive Na+ accumulation in plant roots limited the absorption of iron and resulted in the imbalance of iron under salt stress[19,20]. Now, it is well documented that excess iron could alleviate salt toxicity in plants under salt stress[12,21]. Iron could enhance the activity of antioxidative enzymes, scavenge reactive oxygen species (ROS) and thereby enhance cell defense mechanisms against salinity[2224]. Under salt stress, appropriate excess iron reduce the accumulation of Na+ in chamomile and improve the absorption of K+[12]. Another study showed that excessive iron increased the contents of Fe2+, Zn2+, and K+ in shoots of tomato, and increased the activities of catalase (CAT), and ascorbate peroxidase (APX) in leaves under salt stress[24]. These results indicate that excessive iron can alleviate the adverse effects of salt stress on plants to a certain extent.

      The objectives of the present study were to select an appropriate excess iron (Fe (II) EDTA) concentration for improving salt tolerance of seashore paspalum plants, analyze tissue-specific responses of ion contents, and detect the expression level of salt tolerance regulating genes in seashore paspalum plants exposed to salt stress and excess iron.

    • Plants of seashore paspalum ('Sea Isle 2000') were vegetatively propagated from erect stems cultivated in the grass germplasm resource nursery at Nanjing Agricultural University (Nanjing, Jiangsu Province, China). Ten erect stems were randomly selected and fixed with a sponge on a circular foam board and the plants were fixed with six sponges. The plants were then cultivated in hydroponic culture in plastic containers (10 cm in height and 15 cm in diameter) filled with 1 L half-strength Hoagland's nutrient solution[25] in a growth chamber. The nutrient solution was replaced once every 3 d and not ventilated during the cultivation and treatment. Plants were established in the growth chamber for 20 d with 30/25 °C day/night temperatures with a 14 h photoperiod with 6,000 LX light intensity. The plants cultivated in one plastic container represented an independent biological repetition, and three independent biological repetitions were used in each different treatment in this study.

    • Seven different Fe (II) EDTA concentrations were used in the experiment: 0 μmol, 10 μmol, 20 μmol, 30 μmol, 50 μmol, 80 μmol, and 100 μmol. After 10 d of treatment, plant phenotypes were observed and photographed.

    • Four treatments were designed to explore the effect of iron nutrition on salt tolerance of seashore paspalum: The control group (C): 20 μM Fe (II) EDTA + 0 mM NaCl; salt treatment (CS): 20 μM Fe (II) EDTA + 250 mM NaCl; excessive iron treatment (E): 80 μM Fe (II) EDTA + 0 mM NaCl; excessive iron and salt treatment (ES): 80 μM Fe (II) EDTA + 250 mM NaCl. 1/2 Hoagland nutrient solution including NaCl or Fe (II) EDTA were added at once. Samples were taken on 0 d and 10 d of salt stress treatment for physiological and ion content analysis.

    • Leaf photochemical efficiency (Fv/Fm) was measured using a fluorescence induction monitor (OPTI-Sciences, Hudson, USA). Leaves were dark-adapted for 30 min before the measurement. Relative chlorophyll content (SPAD) was measured using the chlorophyll meter (SPAD-502, Konica Minolta, Japan).

    • The chlorophyll content of leaves was measured according to the method of Hiscox & Israelstam[26]. Leaf chlorophyll was extracted by soaking 0.05 g fresh samples in 10 mL dimethyl sulfoxide (DMSO) and kept in the dark until full extraction. The absorbance was measured at 665 nm and 649 nm using a spectrophotometer (Ultrospec 2100 pro, Amersham, USA), and the concentration of chlorophyll was calculated according to the following equations: Ca = 13.95 × A665 − 6.88 × A649; Cb = 24.96 × A649 − 7.32 × A665; Chlorophyll (mg/g DW) = (pigment concentration × extraction liquid volume)/dry weight.

    • Electrolyte leakage (EL) of leaves was measured according to the method of Blum & Ebercon[27]. About 0.2 g of fresh leaves were weighed and placed into a 50 mL centrifuge tube containing 30 mL deionized water. The centrifuge tubes were placed on a shaker for 24 h at room temperature and the initial conductivity (C0) was measured. Afterward, leaf tissues were killed by autoclaving at 121 °C for 15 min, and the final conductivity (Cl) was measured after the tubes were placed back on the sharker for another 24 h. The EL was calculated as: EL = C0/Cl × l00%.

    • Net photosynthetic rate (Pn) of plant leaves was measured using a LI-6400XT portable photosynthesis system (LI-COR Inc., NE, USA) equipped with a standard 2 cm × 3 cm chamber with light-emitting diode light sources. All the measurements were taken under a light intensity of 600 μmol/m2/s and at a CO2 concentration of 400 μmol/mol with a constant flow rate of 300 μmol/s.

    • Root activity was measured using the TTC method[28]. Five mL of 0.4% TTC solution (m/v) and 5 mL of phosphoric acid buffer (pH = 7.0) were added into 0.5 g root tip samples. The roots were completely immersed in the solution and kept in darkness at 37 °C for 1−2 h. Then, 2 mL of 1 mol/L sulfuric acid was added to terminate the reaction. The liquids were then removed and the remained root samples were ground thoroughly with 4 mL ethyl acetate. The supernatants were collected in a new test tube and the final volume was adjusted to 10 mL with ethyl acetate. The absorbance was measured at 485 nm using a spectrophotometer (Ultrospec 2100 pro, Amersham, USA), and root activity was calculated as follows: Root Activity = TTC reduction amount/(1,000 × root weight × reaction time) [mg TTF/(g·h)].

    • Plant samples were taken on 0 d and 10 d after salt stress treatment and the shoots and roots were separated, oven-dried to a constant weight, and ground to a fine powder. About 0.1 g ground sample was decomposed for 45 min at 160 °C by a microwave (ETHOS ONE, Milestone, Italy), using 3 mL 65% nitric acid as the digestion solution. After that, the liquid was diluted to 30 mL with deionized water. The contents of K, Na, Fe, P, Ca, Mg, Mn, Zn, and Cu ions were determined by an ICP-OES (Optima 8000, Perkin Elmer, USA). The ranges of calibration were 0−60 mg/L (Na, K), 0−30 mg/L (P, Ca), 0−10 mg/L (Mg, Mn), 0−2 mg/L (Zn), 0−0.2 mg/L (Fe, Cu), respectively. Seven concentrations were diluted according to a halving gradient of each calibration, respectively.

    • Total RNA was extracted from seashore paspalum roots which were collected on the 10th day. Using Plant RNA Kit (R6827, Omega, USA), and then reverse-transcribed to cDNA using MonScript™ RTIII Super Mix with dsDNAse (MR05201, Monad, China). qRT-PCR analysis was performed with Roche LightCycler480 II machine (Roche Diagnostic, Rotkreuz, Switzerland) and the MonAmpTM ChemoHS qPCR Mix (MQ00401, Monad, China) as the intercalating dye to detect gene expression level. The operating procedure included 1 × qPCR mix, 0.2 μM primer, 10−200 ng/μL cDNA template, and nuclease-free water up to 20 μL. Thermocycling conditions for a PCR: 95 °C, 10 min; 95 °C, 10 s, 55−65 °C, 10 s, 72 °C, 30 s, 40 cycles.

      Gene expression levels were calculated by the 2−ΔΔCᴛ method[29] with PvEF1α as the reference gene. Primer sequences are listed in Table 1.

      Table 1.  Primers of genes used for qRT-PCR analysis.

      Gene Primer sequences 5'-3' (RT-F/RT-R)
      PvSOS1 GCTTGAAGAGGGACGAATAAA/ACGAAGAAATGCAGCACAGAT
      PvCIPK24 GGCTTAATGAGGTGTTGGCTG/TGGTAAACTCCTTTGCTGTGG
      PvCBL4 GCGCCGACATCAGACAAGA/CGAGCAATGCCAAGACCAT
      PvPHA CAGGAAGTACCCGAGAAATCA/CGTTAACACCAAGAACAAGAGC
      PvVHA CTCTCCTCCTGGTGGTGGTTT/CCTCACGTGCTTTTGTCCTAATAT
      PvHKT1 CCATCATCTACAACATTTGTGC/TCATTTCTGAGCCTTCTCCTC
      PvEF1α GCGGACTGTGCTGTGCTTATC/AGTGGTGGCATCCATCTTGTT
    • All experimental data were statistically analyzed and processed by SPSS (Statistical Package for the Social Science, Chicago, IL, USA) and Excel. The analysis of data types used single factor analysis of variance.

    • To screen the iron absorption threshold of Sea Isle 2000, seven iron concentration gradients were designed. As shown in Fig. 1, plants provided with 0 and 10 μM Fe-EDTA showed obvious iron deficiency symptoms, with yellow leaves and stems. SPAD and Fv/Fm of leaves increased with the increase of iron concentration until 20 μM and tended to be relatively stable when iron concentration was higher than 20 μM, and SPAD content peaked at 80 μM Fe (II) EDTA (Fig. 1). Based on these results, the iron concentration threshold for normal growth of Sea Isle 2000 was set at 20 μM and 80 μM Fe (II) EDTA was selected for the excess iron treatment in the following experiment.

      Figure 1. 

      Screening of optimum concentration of iron in seashore paspalum. (a)−(g) The phenotype of different concentrations iron in seashore paspalum. (h) Indexes of relative chlorophyll content (SPAD) and photochemical efficiency (Fv/Fm). The mean value and standard error were obtained from three biological replicates of every index.

    • Under non-stress conditions, excessive iron (80 μM Fe (II) EDTA) had no significant effect on plant appearance, biomass, and root activity (Fig. 2). Under salt stress condition, plants with excessive iron (80 μM Fe (II) EDTA) showed greener appearance, significantly higher shoot biomass and root activity than plants with optimal iron (20 μM Fe (II) EDTA). Excessive Fe (II) EDTA had no significant effects on electrolyte leakage, chlorophyll content, Fv/Fm, and Pn under non-stress conditions, but helped to maintain significantly higher chlorophyll content, Fv/Fm and Pn and lower electrolyte leakage under salt stress (Fig. 2).

      Figure 2. 

      The appearance and physiological indexes of seashore paspalum under different treatments. (a)−(d) The control group. (e) The treatment of 20 μM Fe (II) EDTA + 0 mM NaCl (C); (f) The treatment of 20 μM Fe (II) EDTA + 250 mM NaCl (CS); (g) The treatment of 80 μM Fe (II) EDTA + 0 mM NaCl (E); (h) The treatment of 80 μM Fe (II) EDTA + 250 mM NaCl (ES). (i)−(n) Physiological indexes of biomass, electrolyte leakage (EL), root activity, chlorophyll content, net photosynthetic rate (Pn), and leaf photochemical efficiency (Fv/Fm) successively, the mean value and standard error were obtained from 3 biological replicates of every physiological index, and the significance difference level p < 0.05.

    • The ion content of K+, Na+, P, Ca2+, Mg2+, Mn2+, Zn2+, Fe2+, and Cu2+, as well as Na+/K+ ratio in roots and shoots showed no significant difference before salt stress. Salt stress significantly increased the content of Na+ and the ratio of Na+/K+ in both shoots and roots. However, excess Fe (II) EDTA increased the content of K+, decreased the ratio of Na+/K+ in roots, reduced the content of Na+ in roots, and increased Na+ content in shoots under salt stress. Salt treatment significantly reduced the content of P in roots, while excess Fe (II) EDTA had no significant effect on P content. In addition, excess Fe (II) EDTA increased Ca2+ content under salt stress and significantly increased the content of Mg2+ in roots regardless of salt stress.

      Excessive Fe (II) EDTA also affected the changes of trace elements in Sea Isle 2000 under salt stress. Salt stress decreased the content of Mn2+ in roots, but increased its content in shoots. Excessive Fe (II) EDTA significantly increased the content of Mn2+ in non-stress and alleviated the decreasing trend of Mn2+ under salt stress in roots. Excessive Fe (II) EDTA increased the contents of Fe2+ and Cu2+ under non-stress conditions and increased the Fe2+ content in roots under salt stress.

    • To further clarify the molecular mechanism of excess Fe (II) EDTA on improving salt tolerance of seashore paspalum, the expression level genes of encoding ions transporter (PvSOS1, PvHKT1, PvCIPK24, PvCBL4), proton pump (PvPHA, PvVHA) in the roots of Sea Isle 2000 were analyzed. The result showed that salt stress decreased the expression level of PvSOS1, PvCIPK24, PvCBL4, PvHKT1, and PvPHA, while excessive Fe (II) EDTA significantly improved their expression under salt stress (Fig. 3ae). Under normal conditions, the expression of PvCBL4, PvHKT1, and PvPHA were lower when iron was excessive (Fig. 3ce). PvVHA didn't show significant changes in response to salt stress but significantly increased in response to excess Fe (II) EDTA under both control and salt stress (Fig. 3f).

      Figure 3. 

      Effects of excess iron on relative expression level of PvSOS1, PvCIPK24, PvCBL4, PvHKT1, PvPHA, and PvVHA in seashore paspalum roots under salt stress. (C), 20 μM Fe (II) EDTA + 0 mM NaCl; (CS), the treatment of 20 μM Fe (II) EDTA + 250 mM NaCl; (E), the treatment of 80 μM Fe (II) EDTA + 0 mM NaCl; (ES), the treatment of 80 μM Fe (II) EDTA + 250 mM NaCl. The mean value and standard error were obtained from five biological replicates, and the significance difference level p < 0.05.

    • Iron deficiency directly leads to decreased or even stopped chlorophyll synthesis, significantly decreased photosynthetic rate, yellowing of leaves, decreased biomass, and other symptoms[12]. In the process of exploring the iron nutrient threshold of seashore paspalum, it was found that the symptoms of iron deficiency occurred when the iron concentration was lower than required for plant growth. Nevertheless, there was no iron deficiency in seashore paspalum when the Fe (II) EDTA concentration was higher than 20 μM (Fig. 1). Therefore, 20 μM Fe (II) EDTA can be used as an optimum concentration of iron for studying iron absorption in seashore paspalum.

      The report referred that a homeostasis and high availability of iron improved the biomass and quality of plants[15]. EDTA acts as a chelating function, increasing the solubility and stability of inorganic ions, while excess EDTA reduces the biomass of plants[30]. In the present study, salt stress inhibited the growth of seashore paspalum under 20 μM Fe (II) EDTA, while the biomass of samples treated by 80 μM Fe (II) EDTA was higher substantially compared with 20 μM Fe (II) EDTA under salt stress. It indicated that excessive iron changed the adverse effect of EDTA on biomass. Previous studies have shown that chlorophyll synthesis and photosynthesis in plant leaves are strongly inhibited when plants are exposed to high salinity, which limits plant growth and development[31,32]. In the present study, salt stress reduced chlorophyll content and photosynthesis of seashore paspalum, while excessive Fe (II) EDTA reduced chlorophyll degradation, and significantly increased chlorophyll content, and photosynthetic capacity of leaves (Fig. 2). Chlorophyll is the main pigment for photosynthesis located on the thylakoid membrane, but the stability of the thylakoid membrane is affected by stress[33]. Under salt stress, the activities of chlorophyll degradation enzymes are activated, resulting in chlorophyll degradation and a decrease in leaf photosynthesis[34]. Leaf photochemical efficiency (Fv/Fm) is the maximum photochemical quantum yield of PSII or the light energy conversion efficiency reflecting the maximum PSII, which has little change under abiotic stress and is independent of species and growth conditions, and it is the survival mechanism of plants to adapt to stress[35,36]. In the present study, Fv/Fm decreased under salt stress but increased by excessive Fe (II) EDTA treatment (Fig. 2). According to the above, excessive Fe (II) EDTA under salt stress can enhance the photosynthetic capacity of plants, maintain the viability and growth potential of seashore paspalum, and improve the salt tolerance.

    • Salt stress seriously affects the balance of inorganic ions in plants, and the sharp increase of Na+ inhibits the absorption of other ions in plants[37,38]. When plants were supplied with excessive iron, the accumulation of Na+ was reduced and increased the absorption of K+ and Fe2+[12]. In this study, excessive Fe (II) EDTA significantly increased K+ content in roots under salt stress, while the accumulation of Na+ and the ratio of Na+/K+ decreased significantly (Table 2). It is supposed that excessive Fe (II) EDTA can promote the absorption of K+, and reduce the content of Na+ in roots, thereby reducing the accumulation of harmful ions and maintaining the homeostasis of ions in roots, and improving the salt tolerance of plants.

      Table 2.  The ion content in seashore paspalum before and after 10 d under different treatments (mg/g DW).

      Treatment days 0 day 10 day
      C CS E ES C CS E ES
      Roots Na/K 0.502a 0.557a 0.565a 0.583a 0.519c 6.344a 0.612c 4.232b
      K 4.634a ± 0.079 4.524a ± 0.121 4.341a ± 0.097 4.569a ± 0.174 4.236b ± 0.160 4.040b ± 0.079 4.677a ± 0.126 4.631a ± 0.079
      Na 2.324a ± 0.092 2.517a ± 0.050 2.450a ± 0.099 2.648a ± 0.101 2.198c ± 0.100 25.622a ± 0.327 2.856c ± 0.391 19.561b ± 0.816
      P 11.320a ± 0.059 10.860a ± 0.064 11.460a ± 0.818 11.830a ± 0.468 11.850a ± 0.092 8.180c ± 0.718 10.420ab ± 0.501 9.140bc ± 0.409
      Ca 7.020a ± 0.449 7.575a ± 0.195 7.726a ± 0.184 7.152a ± 0.015 7.578b ± 0.283 7.752b ± 0.116 7.802b ± 0.339 9.388a ± 0.379
      Mg 2.236a ± 0.187 1.943a ± 0.030 2.339a ± 0.l82 2.169a ± 0.099 2.129b ± 0.040 2.041b ± 0.003 2.355a ± 0.054 2.448a ± 0.068
      Mn 3.762a ± 0.104 3.788a ± 0.127 3.684a ± 0.177 3.804a ± 0.067 3.630b ± 0.061 1.006d ± 0.062 4.002a ± 0.159 1.725c ± 0.085
      Zn 0.501a ± 0.028 0.484a ± 0.009 0.508a ± 0.028 0.459a ± 0.029 0.514a ± 0.010 0.403bc ± 0.045 0.464ab ± 0.018 0.368c ± 0.011
      Fe 0.0252a ± 0.0016 0.0247a ± 0.0018 0.0247a ± 0.0017 0.0272a ± 0.0015 0.0240bc ± 0.0034 0.0174c ± 0.0040 0.0738a ± 0.0017 0.0307b ± 0.0008
      Cu 0.0109a ± 0.0011 0.0102a ± 0.0002 0.0091a ± 0.0007 0.0112a ± 0.0002 0.0100b ± 0.0004 0.0103b ± 0.0001 0.0193a ± 0.0024 0.0116b ± 0.0008
      Shoots Na/K 0.011a 0.010a 0.009a 0.009a 0.007b 0.436a 0.007b 0.415a
      K 23.100a ± 0.514 22.360a ± 0.890 22.530a ± 0.334 23.740a ± 1.302 24.810a ± 1.096 19.380b ± 0.693 25.820a ± 0.055 21.730b ± 0.869
      Na 0.265a ± 0.054 0.231a ± 0.015 0.205a ± 0.010 0.217a ± 0.022 0.176c ± 0.022 8.453b ± 0.310 0.169c ± 0.040 9.007a ± 0.474
      P 8.676a ± 0.511 8.587a ± 0.395 8.782a ± 0.279 8.386a ± 0.389 8.313a ± 0.785 7.683a ± 0.186 8.190a ± 0.496 8.440a ± 0.154
      Ca 3.357a ± 0.024 3.505a ± 0.086 3.320a ± 0.053 3.544a ± 0.091 3.458a ± 0.071 3.472a ± 0.167 3.721a ± 0.154 3.370a ± 0.130
      Mg 1.440a ± 0.051 1.513a ± 0.020 1.461a ± 0.036 1.507a ± 0.020 1.476a ± 0.080 1.437a ± 0.117 1.583a ± 0.026 1.482a ± 0.086
      Mn 0.419a ± 0.037 0.394a ± 0.023 0.405a ± 0.022 0.411a ± 0.023 0.386c ± 0.008 0.451ab ± 0.030 0.467ab ± 0.042 0.476a ± 0.011
      Zn 0.277a ± 0.021 0.286a ± 0.015 0.254a ± 0.014 0.276a ± 0.018 0.265a ± 0.154 0.262a ± 0.013 0.238a ± 0.015 0.243a ± 0.017
      Fe 0.0040a ± 0.0010 0.0034a ± 0.0004 0.0039a ± 0.0003 0.0031a ± 0.0008 0.0032a ± 0.0009 0.0027a ± 0.0008 0.0044a ± 0.0003 0.0033a ± 0.0007
      Cu 0.0049a ± 5.805E-05 0.0047a ± 0.0001 0.0049a ± 9.293E-05 0.0047a ± 0.0001 0.0045b ± 0.0002 0.0043b ± 0.0002 0.0053a ± 0.0003 0.0048ab ± 0.0002
      (C), 20 μM Fe (II) EDTA + 0 mM NaCl; (CS), the treatment of 20 μM Fe (II) EDTA + 250 mM NaCl; (E), the treatment of 80 μM Fe (II) EDTA + 0 mM NaCl; (ES), the treatment of 80 μM Fe (II) EDTA + 250 mM NaCl. Different lowercase letters represents the significance difference level p < 0.05 between C, CS, E and ES treatment.

      In this study, it was found that the Ca2+ content under salt stress was not significantly different from that under normal growth conditions, but it was significantly increased by excessive Fe (II) EDTA treatment (Table 2). Ca2+ is known as a second messenger in plants and is involved in the process of plant responses to stress[39,40]. A previous study has shown that calcium functions as a long-distance signaling messenger, carrying salt stress signals to induce the expression of salt tolerance genes in leaves[41]. In the present study, excessive Fe (II) EDTA stimulated the increase of Ca2+ in roots, thereby inducing the production of calcium signals under salt stress. Mg2+ is the main mineral element of chlorophyll, which mainly affects the photosynthesis of plants and the synthesis of sugar and protein[42]. The results of this study (Table 2) indicated that the excess Fe (II) EDTA under salt stress could contribute to the absorption of Mg2+, maintain the normal transport and distribution of Mg2+ in the plant.

      As an essential trace element for plants, iron affects the growth and development of plants. Plants with iron deficiency all show green loss of leaves, become dwarfism, and even whole death[12]. In saline-alkali soil, absorption of iron in plants was inhibited, and excessive accumulation of Na+ in plants of stems reduced the content of Fe2+ and other nutrient elements in plants[19]. Under salt stress, the content of Fe2+ decreased in shoots and roots of seashore paspalum. It indicates that salt stress inhibited the absorption, transportation, and distribution of iron. However, excessive Fe (II) EDTA alleviated the inhibition effect of salt stress on Fe2+ and significantly increased the content in the roots (Table 2). The improvement is beneficial to promote the formation of chlorophyll in leaves and promotes normal metabolism, enhancing the salt tolerance of plants.

      The function of Mn2+ in plants by affecting enzyme activity, and the content of Mn2+ is directly related to the formation of chloroplast membrane structure[43,44]. In this study, excessive Fe (II) EDTA treatment increased the content of Mn2+ in plants under salt stress, maintained the function of Mn2+ in the oxidation-reduction system, avoided serious damage of chloroplasts, and enhanced the photosynthesis of leaves under salt stress. On the other hand, a previous study reported that the free EDTA could chelate with Zn2+, Cu2+, and Mn2+ affecting the absorption of these ions in plants[30]. In this study, the contents of Zn2+, and Cu2+ were not significantly different whether normal iron (20 μM Fe (II) EDTA) or excessive iron (80 μM Fe (II) EDTA). It indicated that excessive iron increases the absorption of ions when injected with the same concentration EDTA under salt stress.

    • Plant response to salt stress is a complex process, including induction and transmission of external salt signals at the molecular level, which stimulates the expression of various downstream physiological and biochemical genes or ion transporters to maintain ion homeostasis[45]. Under salt stress, excessive accumulation of Na+ in plants can cause ion toxicity, and exportation or regionalization of Na+ is one of the self-protection mechanisms to eliminate ion toxicity[46]. To maintain intracellular ions homeostasis under salt stress, Na+/H+ antiporter and proton pump are activated to maintain high K+ concentration and low Na+ concentration[4749]. The SOS1 gene encodes Na+/H+ antiporter located on the plasma membrane, and functions to expel intracellular Na+ into the extracellular[3,48,50]. SOS2/CIPK24 and SOS3/CBL4 participate in the regulation of SOS1 gene, promoting the activity of SOS1 regulating Na+/H+ exchange[51]. In addition, CIPK24 regulates Ca2+ transport through the Ca2+ transporter CAX1 on the vacuolar membrane, and sensing the stimulated calcium signal, and specifically binds with CBL4 to form a complex to regulate salt stress and activate SOS1 activity, thereby increasing salt tolerance[51,52]. In this study, it was found that excessive Fe (II) EDTA significantly upregulated the expression of PvSOS1, PvCIPK24, and PvCBL4 in the roots under salt stress, suggesting that the upregulated expression improved the ability that PvCBL4 recruit PvCIPK24 to the plasma membrane to achieve efficient interaction with PvSOS1.

      The transport protein requires energy to transfer Na+ to the extracellular or vacuole, while the proton pump (P-H+-ATPase (PHA), V-H+-ATPase (VHA)) can provide a proton driving force for this process by hydrolyzing ATP[53]. It has been suggested that V-H+-ATPase plays a pivotal role in salt stress, which provides proton driving force, and expels Na+ to extra-cellular milieu or into the vacuole[45,54,55]. P-H+-ATPase provides an active mechanism for Na+ extrusion to keep Na+ concentration in root cells below the threshold level of toxicity[56,57]. In the present study, the expression levels of PvVHA and PvPHA were significantly increased by excess Fe (II) EDTA treatment under salt stress, which could drive Na+/H+ antiporter protein in vacuole membrane to transport Na+ into vacuole or expel the Na+ from plasma membrane.

      HKT is a high-affinity K+ transporter, which plays a decisive role in regulating intracellular Na+/K+ equilibrium[10,58,59]. Many studies have shown that HKT has the function of transporting other cations (such as Na+)[60,61]. Two types of HKTs exist in plants (HKT1 and HKT2). HKT1 is functional in transporting Na+ and K+ within plants and is linked to salt tolerance[6264]. In the present study, excessive Fe (II) EDTA treatment upregulated the expression levels of PvHKT1 in roots under salt stress compared with normal and salt stress treatment (Fig. 3d). Combined with the decrease of Na+/K+ ratio by excess Fe (II) EDTA treatment under salt stress (Table 2), it is supposed that the increasing of PvHKT1 in roots regulated the transport of Na+ and K+ from root to shoot, sustained the Na+/K+ homeostasis under salt stress, and reduced the toxicity of salt stress.

    • In the present study, salinity stress severely inhibited the growth and physiological function of seashore paspalum. The application of appropriate excess Fe (II) EDTA increased the photosynthetic capacity and improved the ion balance of seashore paspalum under salt stress. Excessive Fe (II) EDTA enhanced the outflow of Na+ by increasing the expression of PvSOS1, PvCIPK24, and PvCBL4, and reduced the accumulation of excess Na+. The up-regulation of PvHKT1 positively regulated Na+ and K+ flow, PvVHA provided energy for transporting excess Na+ to the vacuole, helped to maintain the balance of intracellular Na+/K+, and thus improved salt tolerance of seashore paspalum (Fig. 4).

      Figure 4. 

      Abstract figure to illustrate the result of how excess Fe improved salt tolerance under salt stress.

      • This work was supported by the program of the National Natural Science Foundation of China NSFC (32071876, 32101437) and the China Postdoctoral Science Foundation (2018T110518, 2017M611842).

      • The authors confirm contribution to the paper as follows: study conception and design: Chen Y, Yang Z, Li Z; data collection, data analysis: Zheng Y, Tan Z; manuscript writing: Liu J, Hu J; manuscript review and editing: Liu Y, Zhang X. All authors reviewed the results and approved the final version of the manuscript.

      • All data generated or analyzed during this study are included in this published article.

      • The authors declare that they have no conflict of interest.

      • Copyright: © 2025 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (4)  Table (2) References (64)
  • About this article
    Cite this article
    Zheng Y, Li Z, Tan Z, Liu Y, Zhang X, et al. 2025. Iron (II)-EDTA alleviate salinity injury through regulating ion balance in halophyte seashore paspalum. Grass Research 5: e002 doi: 10.48130/grares-0024-0029
    Zheng Y, Li Z, Tan Z, Liu Y, Zhang X, et al. 2025. Iron (II)-EDTA alleviate salinity injury through regulating ion balance in halophyte seashore paspalum. Grass Research 5: e002 doi: 10.48130/grares-0024-0029

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return