Search
2026 Volume 2
Article Contents
ARTICLE   Open Access    

The mannose-binding lectin gene CsMBL1 positively regulates resistance to citrus canker

  • # Authors contributed equally: Man Li, Qingwei Song

More Information
  • Received: 25 September 2025
    Revised: 10 November 2025
    Accepted: 17 November 2025
    Published online: 09 January 2026
    Plant Hormones  2 Article number: e001 (2026)  |  Cite this article
  • Citrus canker is a serious bacterial disease caused by Xanthomonas citri (Xcc) subsp. citri. It is a significant threat to the citrus industry. Plants have several defense proteins, including mannose-binding lectins (MBL), which modulate innate immune responses by recognizing and binding to carbohydrates on microbial surfaces. However, the role of MBL in citrus canker resistance remains elusive. Previous transcriptomic analysis revealed that in the leaves of the citrus canker-resistant variety Kumquat (Citrus japonica), and the susceptible variety WanJincheng (Citrus sinensis) treated with Xcc, higher levels of CsMBL1 were detected in the former compared to the latter, suggesting that CsMBL1 is associated with resistance to citrus canker. Therefore, this study analyzed and identified a mannose-binding B-lectin gene, CsMBL1, and obtained the following results. Subcellular localization results indicated that CsMBL1 is localized in the nucleus. Phytohormone induction experiments demonstrated that methyl jasmonate (MeJA) downregulated the expression of CsMBL1 in Kumquat, while upregulating it in Wanjincheng. Moreover, its overexpression increased citrus canker resistance, while virus-induced gene silencing (VIGS) increased susceptibility. Biochemical analyses revealed increased reactive oxygen species (ROS) content, reduced peroxidase (POD) activity, and increased respiratory burst oxidase homologs (RBOHs) activity in CsMBL1-overexpressing plants. Additionally, the levels of abscisic acid (ABA) and jasmonic acid (JA) were diminished, while the salicylic acid (SA) level was elevated. These findings suggest that CsMBL1 acts as a positive regulator of citrus canker resistance by modulating JA, ABA, SA, and ROS levels; therefore, CsMBL1 can be targeted for modulation to develop canker-resistant citrus cultivars.
  • 加载中
  • Supplementary Table S1 Sequences used in this study.
    Supplementary Table S2 MBLs used for phylogenetic analyses.
  • [1] Zou X, Du M, Liu Y, Wu L, Xu L, et al. 2021. CsLOB1 regulates susceptibility to citrus canker through promoting cell proliferation in citrus. The Plant Journal 106:1039−1057 doi: 10.1111/tpj.15217

    CrossRef   Google Scholar

    [2] Peng A, Chen S, Lei T, Xu L, He Y, et al. 2017. Engineering canker-resistant plants through CRISPR/Cas9-targeted editing of the susceptibility gene CsLOB1 promoter in citrus. Plant Biotechnology Journal 15:1509−1519 doi: 10.1111/pbi.12733

    CrossRef   Google Scholar

    [3] Marothia D, Kaur N, Jhamat C, Sharma I, Pati PK. 2023. Plant lectins: classical molecules with emerging roles in stress tolerance. International Journal of Biological Macromolecules 244:125272 doi: 10.1016/j.ijbiomac.2023.125272

    CrossRef   Google Scholar

    [4] Azarkan M, Feller G, Vandenameele J, Herman R, El Mahyaoui R, et al. 2018. Biochemical and structural characterization of a mannose binding jacalin-related lectin with two-sugar binding sites from pineapple (Ananas comosus) stem. Scientific Reports 8:11508 doi: 10.1038/s41598-018-29439-x

    CrossRef   Google Scholar

    [5] Liu Y, Lin Y, Wei F, Lv Y, Xie F, et al. 2023. G-type receptor-like kinase AsNIP43 interacts with rhizobia effector nodulation outer protein P and is required for symbiosis. Plant Physiology 193:1527−1546 doi: 10.1093/plphys/kiad318

    CrossRef   Google Scholar

    [6] Wang M, Peng X, Chen Z, Tang X. 2020. Research advances on lectin receptor-like kinases in plants. Chinese Bulletin of Botany 55:96−105 (in Chinese) doi: 10.11983/CBB19130

    CrossRef   Google Scholar

    [7] Wang F, Li Y, Li G, Chen S. 2023. Genetic components of self-incompatibility in Brassica vegetables. Horticulturae 9:265 doi: 10.3390/horticulturae9020265

    CrossRef   Google Scholar

    [8] Gao Q, Yin X, Wang F, Hu S, Liu W, et al. 2023. OsJRL40, a jacalin-related lectin gene, promotes salt stress tolerance in rice. International Journal of Molecular Sciences 24:7441 doi: 10.3390/ijms24087441

    CrossRef   Google Scholar

    [9] He X, Li L, Xu H, Xi J, Cao X, et al. 2017. A rice jacalin‐related mannose‐binding lectin gene, OsJRL, enhances Escherichia coli viability under high salinity stress and improves salinity tolerance of rice. Plant Biology 19:257−267 doi: 10.1111/plb.12514

    CrossRef   Google Scholar

    [10] Jung IJ, Ahn JW, Jung S, Hwang JE, Hong MJ, et al. 2019. Overexpression of rice jacalin-related mannose-binding lectin (OsJAC1) enhances resistance to ionizing radiation in Arabidopsis. BMC Plant Biology 19:561 doi: 10.1186/s12870-019-2056-8

    CrossRef   Google Scholar

    [11] Yan X, Huang Y, Song H, Chen F, Geng Q, et al. 2021. A MYB4-MAN3-Mannose-MNB1 signaling cascade regulates cadmium tolerance in Arabidopsis. PLoS Genetics 17:e1009636 doi: 10.1371/journal.pgen.1009636

    CrossRef   Google Scholar

    [12] Choteau L, Parny M, François N, Bertin B, Fumery M, et al. 2016. Role of mannose-binding lectin in intestinal homeostasis and fungal elimination. Mucosal Immunology 9:767−776 doi: 10.1038/mi.2015.100

    CrossRef   Google Scholar

    [13] He P, Jia H, Xue H, Zeng Y, Tian L, et al. 2022. Expression of modified snowdrop lectin (Galanthus nivalis Agglutinin) protein confers aphids and Plutella xylostella resistance in Arabidopsis and cotton. Genes 13:1169 doi: 10.3390/genes13071169

    CrossRef   Google Scholar

    [14] Ohizumi Y, Gaidamashvili M, Ohwada S , Matsuda K, Kominami J, et al. 2009. Mannose-binding lectin from yam (Dioscorea batatas) tubers with insecticidal properties against Helicoverpa armigera (Lepidoptera: Noctuidae). Journal of Agricultural and Food Chemistry 57:2896−2902 doi: 10.1021/jf8040269

    CrossRef   Google Scholar

    [15] Yan L, Luo T, Huang D, Wei M, Ma Z, et al. 2023. Recent advances in molecular mechanism and breeding utilization of brown planthopper resistance genes in rice: an integrated review. International Journal of Molecular Sciences 24:12061 doi: 10.3390/ijms241512061

    CrossRef   Google Scholar

    [16] Miao J, Wu Y, Xu W, Hu L, Yu Z, et al. 2011. The impact of transgenic wheat expressing Gna (snowdrop lectin) on the aphids Sitobion avenae, Schizaphis graminum, and Rhopalosiphum padi. Environmental Entomology 40:743−748 doi: 10.1603/EN10261

    CrossRef   Google Scholar

    [17] Desaki Y, Kouzai Y, Ninomiya Y, Iwase R, Shimizu Y, et al. 2018. OsCERK1 plays a crucial role in the lipopolysaccharide‐induced immune response of rice. New Phytologist 217:1042−1049 doi: 10.1111/nph.14941

    CrossRef   Google Scholar

    [18] Bevitori R, Sircar S, de Mello RN, Togawa RC, Côrtes MVCB, et al. 2020. Identification of co-expression gene networks controlling rice blast disease during an incompatible reaction. Genetics and Molecular Research 19:gmr18579 doi: 10.4238/gmr18579

    CrossRef   Google Scholar

    [19] Ranf S, Gisch N, Schäffer M, Illig T, Westphal L, et al. 2015. A lectin S-domain receptor kinase mediates lipopolysaccharide sensing in Arabidopsis thaliana. Nature Immunology 16:426−433 doi: 10.1038/ni.3124

    CrossRef   Google Scholar

    [20] Hwang IS, Hwang BK. 2011. The pepper mannose-binding lectin gene CaMBL1 is required to regulate cell death and defense responses to microbial pathogens. Plant Physiology 155:447−463 doi: 10.1104/pp.110.164848

    CrossRef   Google Scholar

    [21] Kim NH, Lee DH, Choi DS, Hwang BK. 2015. The pepper GNA-related lectin and PAN domain protein gene, CaGLP1, is required for plant cell death and defense signaling during bacterial infection. Plant Science 241:307−315 doi: 10.1016/j.plantsci.2015.07.003

    CrossRef   Google Scholar

    [22] Del Rio M, de la Canal L, Pinedo M, Regente M. 2018. Internalization of a sunflower mannose-binding lectin into phytopathogenic fungal cells induces cytotoxicity. Journal of Plant Physiology 221:22−31 doi: 10.1016/j.jplph.2017.12.001

    CrossRef   Google Scholar

    [23] Guidarelli M, Zoli L, Orlandini A, Bertolini P, Baraldi E. 2014. The mannose‐binding lectin gene FaMBL1 is involved in the resistance of unripe strawberry fruits to Colletotrichum acutatum. Molecular Plant Pathology 15:832−840 doi: 10.1111/mpp.12143

    CrossRef   Google Scholar

    [24] Muthamilarasan M, Prasad M. 2013. Plant innate immunity: an updated insight into defense mechanism. Journal of Biosciences 38:433−449 doi: 10.1007/s12038-013-9302-2

    CrossRef   Google Scholar

    [25] Tabassum N, Blilou I. 2022. Cell-to-cell communication during plant-pathogen interaction. Molecular Plant-Microbe Interactions 35:98−108 doi: 10.1094/MPMI-09-21-0221-CR

    CrossRef   Google Scholar

    [26] Mei P, Song Z, Li ZA, Zhou C. 2019. Functional study of Csrbohs in defence response against Xanthomonas citri ssp. citri. Functional Plant Biology 46:543−554 doi: 10.1071/FP18243

    CrossRef   Google Scholar

    [27] Li Q, Xian B, Yu Q, Jia R, Zhang C, et al. 2024. The CsAP2-09-CsWRKY25-CsRBOH2 cascade confers resistance against citrus bacterial canker by regulating ROS homeostasis. Plant Journal 118:534−548 doi: 10.1111/tpj.16623

    CrossRef   Google Scholar

    [28] Zhang M, Li W, Zhang T, Liu Y, Liu L. 2024. Botrytis cinerea-induced F-box protein 1 enhances disease resistance by inhibiting JAO/JOX-mediated jasmonic acid catabolism in Arabidopsis. Molecular Plant 17:297−311 doi: 10.1016/j.molp.2023.12.020

    CrossRef   Google Scholar

    [29] Ding P, Ding Y. 2020. Stories of salicylic acid: a plant defense hormone. Trends in Plant Science 25:549−565 doi: 10.1016/j.tplants.2020.01.004

    CrossRef   Google Scholar

    [30] Xiao YX, Xiao C, Tong Z, He XJ, Wang ZQ, et al. 2025. Four MES genes from calamondin (Citrofortunella microcarpa) regulated citrus bacterial canker resistance through the plant hormone pathway. Frontiers in Plant Science 15:1513430 doi: 10.3389/fpls.2024.1513430

    CrossRef   Google Scholar

    [31] Asselbergh B, Curvers K, França SC, Audenaert K, Vuylsteke M, et al. 2007. Resistance to Botrytis cinerea in sitiens, an abscisic acid-deficient tomato mutant, involves timely production of hydrogen peroxide and cell wall modifications in the epidermis. Plant Physiology 144:1863−1877 doi: 10.1104/pp.107.099226

    CrossRef   Google Scholar

    [32] Audenaert K, De Meyer GB, Höfte MM. 2002. Abscisic acid determines basal susceptibility of tomato to Botrytis cinerea and suppresses salicylic acid-dependent signaling mechanisms. Plant Physiology 128:491−501 doi: 10.1104/pp.010605

    CrossRef   Google Scholar

    [33] Li G, Meng X, Wang R, Mao G, Han L, et al. 2012. Dual-level regulation of ACC synthase activity by MPK3/MPK6 cascade and its downstream WRKY transcription factor during ethylene induction in Arabidopsis. PLoS Genetics 8:e1002767 doi: 10.1371/journal.pgen.1002767

    CrossRef   Google Scholar

    [34] Long Q, Xie Y, He Y, Li Q, Zou X, et al. 2019. Abscisic acid promotes jasmonic acid accumulation and plays a key role in Citrus canker development. Frontiers in Plant Science 10:1634 doi: 10.3389/fpls.2019.01634

    CrossRef   Google Scholar

    [35] Liu H, Wang X, Liu S, Huang Y, Guo YX, et al. 2022. Citrus pan-genome to breeding database (CPBD): a comprehensive genome database for citrus breeding. Molecular Plant 15:1503−1505 doi: 10.1016/j.molp.2022.08.006

    CrossRef   Google Scholar

    [36] Wang J, Chen D, Lei Y, Chang JW, Hao BH, et al. 2014. Citrus sinensis annotation project (CAP): a comprehensive database for sweet orange genome. PLoS One 9:e87723 doi: 10.1371/journal.pone.0087723

    CrossRef   Google Scholar

    [37] Hu B, Jin J, Guo AY, Zhang H, Luo J, et al. 2015. GSDS 2.0: an upgraded gene feature visualization server. Bioinformatics 31:1296−1297 doi: 10.1093/bioinformatics/btu817

    CrossRef   Google Scholar

    [38] Wheeler TJ, Eddy SR. 2013. nhmmer: DNA homology search with profile HMMs. Bioinformatics 29:2487−2489 doi: 10.1093/bioinformatics/btt403

    CrossRef   Google Scholar

    [39] Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35:1547−1549 doi: 10.1093/molbev/msy096

    CrossRef   Google Scholar

    [40] Wang X, Guo R, Tu M, Wang D, Guo C, et al. 2017. Ectopic expression of the wild grape WRKY transcription factor VqWRKY52 in Arabidopsis thaliana enhances resistance to the biotrophic pathogen powdery mildew but not to the necrotrophic pathogen Botrytis cinerea. Frontiers in Plant Science 8:97 doi: 10.3389/fpls.2017.00097

    CrossRef   Google Scholar

    [41] Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCᴛ Method. Methods 25:402−408 doi: 10.1006/meth.2001.1262

    CrossRef   Google Scholar

    [42] Du M, Wang S, Dong L, Qu R, Zheng L, et al. 2022. Overexpression of a "Candidatus liberibacter asiaticus" effector gene CaLasSDE115 contributes to early colonization in Citrus sinensis. Frontiers in Microbiology 12:797841 doi: 10.3389/fmicb.2021.797841

    CrossRef   Google Scholar

    [43] Mafra V, Kubo KS, Alves-Ferreira M, Ribeiro-Alves M, Stuart RM, et al. 2012. Reference genes for accurate transcript normalization in citrus genotypes under different experimental conditions. PLoS One 7:e31263 doi: 10.1371/journal.pone.0031263

    CrossRef   Google Scholar

    [44] Verma V, Ravindran P, Kumar PP. 2016. Plant hormone-mediated regulation of stress responses. BMC Plant Biology 16:86 doi: 10.1186/s12870-016-0771-y

    CrossRef   Google Scholar

    [45] Pitino M, Armstrong CM, Duan Y. 2015. Rapid screening for citrus canker resistance employing pathogen-associated molecular pattern-triggered immunity responses. Horticulture Research 2:15042 doi: 10.1038/hortres.2015.42

    CrossRef   Google Scholar

    [46] Wang W, Chen D, Zhang X, Liu D, Cheng Y, et al. 2018. Role of plant respiratory burst oxidase homologs in stress responses. Free Radical Research 52:826−839 doi: 10.1080/10715762.2018.1473572

    CrossRef   Google Scholar

    [47] Hasanuzzaman M, Raihan MRH, Masud AAC, Rahman K, Nowroz F, et al. 2021. Regulation of reactive oxygen species and antioxidant defense in plants under salinity. International Journal of Molecular Sciences 22:9326 doi: 10.3390/ijms22179326

    CrossRef   Google Scholar

    [48] Hu CH, Wang PQ, Zhang PP, Nie XM, Li BB, et al. 2020. NADPH oxidases: the vital performers and center hubs during plant growth and signaling. Cells 9:437 doi: 10.3390/cells9020437

    CrossRef   Google Scholar

    [49] Dvořák P, Krasylenko Y, Zeiner A, Šamaj J, Takáč T. 2021. Signaling toward reactive oxygen species-scavenging enzymes in plants. Frontiers in Plant Science 11:618835 doi: 10.3389/fpls.2020.618835

    CrossRef   Google Scholar

    [50] Fujita M, Hasanuzzaman M. 2022. Approaches to enhancing antioxidant defense in plants. Antioxidants 11:925 doi: 10.3390/antiox11050925

    CrossRef   Google Scholar

    [51] Hou S, Tsuda K. 2022. Salicylic acid and jasmonic acid crosstalk in plant immunity. Essays in Biochemistry 66:647−656 doi: 10.1042/EBC20210090

    CrossRef   Google Scholar

    [52] Li S, Liu S, Zhang Q, Cui M, Zhao M, et al. 2022. The interaction of ABA and ROS in plant growth and stress resistances. Frontiers in Plant Science 13:1050132 doi: 10.3389/fpls.2022.1050132

    CrossRef   Google Scholar

    [53] Ding LN, Li YT, Wu YZ, Li T, Geng R, et al. 2022. Plant disease resistance-related signaling pathways: recent progress and future prospects. International Journal of Molecular Sciences 23:16200 doi: 10.3390/ijms232416200

    CrossRef   Google Scholar

    [54] Huang X, Su L, Xian B, Yu Q, Zhang M, et al. 2024. Genome-wide identification and characterization of the sweet orange (Citrus sinensis) basic helix-loop-helix (bHLH) family reveals a role for CsbHLH085 as a regulator of citrus bacterial canker resistance. International Journal of Biological Macromolecules 267:131442 doi: 10.1016/j.ijbiomac.2024.131442

    CrossRef   Google Scholar

    [55] Mishra A, Behura A, Mawatwal S, Kumar A, Naik L, et al. 2019. Structure-function and application of plant lectins in disease biology and immunity. Food and Chemical Toxicology 134:110827 doi: 10.1016/j.fct.2019.110827

    CrossRef   Google Scholar

    [56] Ovcharenko OO, Rudas VA. 2023. Modern approaches to genetic engineering in the Orchidaceae famil. Cytology and Genetics 57:142−156 doi: 10.3103/S0095452723020093

    CrossRef   Google Scholar

    [57] Ma L, Haile ZM, Sabbadini S, Mezzetti B, Negrini F, et al. 2023. Functional characterization of MANNOSE-BINDING LECTIN 1, a G-type lectin gene family member, in response to fungal pathogens of strawberry. Journal of Experimental Botany 74:149−161 doi: 10.1093/jxb/erac396

    CrossRef   Google Scholar

    [58] Wu B, Qi F, Liang Y. 2023. Fuels for ROS signaling in plant immunity. Trends in Plant Science 28:1124−1131 doi: 10.1016/j.tplants.2023.04.007

    CrossRef   Google Scholar

    [59] Martinvalet D, Walch M. 2022. Editorial: the role of reactive oxygen species in protective immunity. Frontiers in Immunology 12:832946 doi: 10.3389/fimmu.2021.832946

    CrossRef   Google Scholar

    [60] Kumari S, Nazir F, Maheshwari C, Kaur H, Gupta R, et al. 2024. Plant hormones and secondary metabolites under environmental stresses: Enlightening defense molecules. Plant Physiology and Biochemistry 206:108238 doi: 10.1016/j.plaphy.2023.108238

    CrossRef   Google Scholar

    [61] Saleem M, Fariduddin Q, Castroverde CDM. 2021. Salicylic acid: a key regulator of redox signalling and plant immunity. Plant Physiology and Biochemistry 168:381−397 doi: 10.1016/j.plaphy.2021.10.011

    CrossRef   Google Scholar

    [62] Roychowdhury R, Hada A, Biswas S, Mishra S, Prusty MR, et al. 2025. Jasmonic acid (JA) in plant immune response: unravelling complex molecular mechanisms and networking of defence signalling against pathogens. Journal of Plant Growth Regulation 44:89−114 doi: 10.1007/s00344-024-11264-4

    CrossRef   Google Scholar

    [63] Nie P, Li X, Wang S, Guo J, Zhao H, et al. 2017. Induced systemic resistance against Botrytis cinerea by Bacillus cereus AR156 through a JA/ET- and NPR1-Dependent signaling pathway and activates PAMP-triggered immunity in Arabidopsis. Frontiers in Plant Science 8:238 doi: 10.3389/fpls.2017.00238

    CrossRef   Google Scholar

    [64] Yu Q, He H, Xian B, Zhang C, Zhong X, et al. 2024. The wall-associated receptor-like kinase CsWAKL01, positively regulated by the transcription factor CsWRKY53, confers resistance to citrus bacterial canker via regulation of phytohormone signaling. Journal of Experimental Botany 75:5805−5818 doi: 10.1093/jxb/erae255

    CrossRef   Google Scholar

    [65] Blanco F, Salinas P, Cecchini NM, Jordana X, Van Hummelen P, et al. 2009. Early genomic responses to salicylic acid in Arabidopsis. Plant Molecular Biology 70:79−102 doi: 10.1007/s11103-009-9458-1

    CrossRef   Google Scholar

  • Cite this article

    Li M, Song Q, Lin D, Zhang M, He Y, et al. 2026. The mannose-binding lectin gene CsMBL1 positively regulates resistance to citrus canker. Plant Hormones 2: e001 doi: 10.48130/ph-0025-0028
    Li M, Song Q, Lin D, Zhang M, He Y, et al. 2026. The mannose-binding lectin gene CsMBL1 positively regulates resistance to citrus canker. Plant Hormones 2: e001 doi: 10.48130/ph-0025-0028

Figures(6)

Article Metrics

Article views(2326) PDF downloads(602)

ARTICLE   Open Access    

The mannose-binding lectin gene CsMBL1 positively regulates resistance to citrus canker

Plant Hormones  2 Article number: e001  (2026)  |  Cite this article

Abstract: Citrus canker is a serious bacterial disease caused by Xanthomonas citri (Xcc) subsp. citri. It is a significant threat to the citrus industry. Plants have several defense proteins, including mannose-binding lectins (MBL), which modulate innate immune responses by recognizing and binding to carbohydrates on microbial surfaces. However, the role of MBL in citrus canker resistance remains elusive. Previous transcriptomic analysis revealed that in the leaves of the citrus canker-resistant variety Kumquat (Citrus japonica), and the susceptible variety WanJincheng (Citrus sinensis) treated with Xcc, higher levels of CsMBL1 were detected in the former compared to the latter, suggesting that CsMBL1 is associated with resistance to citrus canker. Therefore, this study analyzed and identified a mannose-binding B-lectin gene, CsMBL1, and obtained the following results. Subcellular localization results indicated that CsMBL1 is localized in the nucleus. Phytohormone induction experiments demonstrated that methyl jasmonate (MeJA) downregulated the expression of CsMBL1 in Kumquat, while upregulating it in Wanjincheng. Moreover, its overexpression increased citrus canker resistance, while virus-induced gene silencing (VIGS) increased susceptibility. Biochemical analyses revealed increased reactive oxygen species (ROS) content, reduced peroxidase (POD) activity, and increased respiratory burst oxidase homologs (RBOHs) activity in CsMBL1-overexpressing plants. Additionally, the levels of abscisic acid (ABA) and jasmonic acid (JA) were diminished, while the salicylic acid (SA) level was elevated. These findings suggest that CsMBL1 acts as a positive regulator of citrus canker resistance by modulating JA, ABA, SA, and ROS levels; therefore, CsMBL1 can be targeted for modulation to develop canker-resistant citrus cultivars.

    • Citrus bacterial canker (CBC) is a plant bacterial disease caused by Xanthomonas citri (Xcc) subsp. citri, resulting in substantial losses to the global citrus industry[1]. CBC can spread through various pathways, making it difficult to prevent and control. The current disease control methods are ineffective; however, producing citrus canker-resistant citrus varieties through molecular breeding techniques can effectively control various diseases[2].

      Plant lectins are a highly diverse group of carbohydrate-binding proteins that play roles in various biological processes. Based on phylogenetic analysis and domain structure, lectins are classified into 12 families, each comprising members derived from a single carbohydrate-binding-related domain[3]. The bulb-type mannose-specific binding lectin (B-lectins) belong to one of these families. These lectins can recognize and bind to mannose, modulating plant defense[4]. Mannose-binding lectins (MBLs) have been associated with plant growth. For instance, the G-type receptor-like kinase AsNIP43 interacts with the rhizobial effector nodulation outer protein P, which is essential for rhizobia-legume symbiosis[5]. Moreover, pollen development requires L-type lectin receptor kinase IV.2 (LECRK-IV.2)[6]. In Brassica, the S-locus receptor kinase containing a B-lectin domain modulates self-incompatibility responses[7].

      The literature has validated that MBL plays a defensive role in many plant species. Furthermore, it is associated with salt stress in rice[8,9]. OsJAC1 overexpression increases Arabidopsis's resistance to ionizing radiation[10]. Moreover, in Arabidopsis, the MYB4-MAN3-mannose-MNB1 signaling cascade regulates cadmium tolerance via the GSH-dependent PC synthesis pathway[11]. MBLs are widespread in higher plants, and can interact with insect gastrointestinal systems, providing immunity against pests[12]. For instance, in transgenic crops, expressing snowdrop lectin GNA or feeding GNA provides resistance to lepidopteran pests[13,14]. In rice, GNA lectin gene overexpression increases resistance to the white-backed planthopper[15]. The upregulation of G-type lectin genes increases aphid resistance by inhibiting growth and fertility[16]. MBLs protect plants against pathogen attack by recognizing specific carbohydrates on pathogen surfaces and acting as a plant defense signaling mechanism. In rice, OsCERK1 plays a key role in lipopolysaccharide (LPS)-induced immune responses[17]. For example, the B-lectin domain-containing gene Pi-d2 confers resistance to rice blast[18]. Arabidopsis G-type lectin LORE, pepper G-type lectin genes CaMBL1 and CaGLP1 are involved in defense against Xanthomonas campestris pv. vesicatoria (Xcv)[1921]. Moreover, in sunflowers, the jacalin-type MBL Helja interacts with fungal spore surfaces, inducing oxidative stress, and leading to cell death[22]. FaMBL1, an MBL gene, provides resistance to immature strawberry fruits against Colletotrichum acutatum[23].

      Plants have various defense mechanisms, such as a complex immune system, to protect themselves against different pathogens[24]. Furthermore, several signaling molecules, such as reactive oxygen species (ROS), ethylene (ET), salicylic acid (SA), and jasmonic acid (JA), have been associated with plant defense networks[25]. The literature suggests that excessive ROS increases resistance against Xcc[26,27]. Moreover, JA and SA are key phytohormones that modulate plant immunity[28,29]. Further, plants confer resistance to citrus canker by regulating endogenous hormones such as JA and SA via multiple pathways[30]. Moreover, abscisic acid (ABA) has been found to negatively regulate resistance against pathogens, such as against Botrytis cinerea and Pseudomonas syringae in tomatoes[31,32]. Similarly, ET has a positive impact on plant disease resistance[33].

      Various studies have investigated the association between MBL and biotic stress; however, its relationship with citrus canker remains unclear. Based on transcriptomic data from earlier infection experiments, using Xcc on citrus germplasms with contrasting resistance phenotypes, consistently higher expression of CsMBL1 in the citrus canker-resistant variety Kumquat (Citrus japonica) was observed compared to the citrus canker-susceptible variety Wanjincheng (Citrus sinensis), across multiple time points. This expression pattern suggested a potential role of CsMBL1 in CBC resistance, which became the focus of this study. To functionally characterize CsMBL1, genetic transformation and virus-induced gene silencing (VIGS) were performed in citrus. Integrated with biochemical assays, the present results reveal a mechanism by which CsMBL1 contributes to CBC resistance. It was observed that CsMBL1 contributes to the development of novel citrus canker-resistant citrus germplasm.

    • The Kumquat (C. japonica) and Wanjincheng (C. sinensis) citrus varieties were obtained from the National Citrus Germplasm Repository (Chongqing, China) and grown in a greenhouse at 28 °C for 3−5 months. Wanjincheng plants have greater susceptibility to citrus canker than Kumquat plants[34]. The Xcc variant, XccYN1, was isolated from infected citrus leaves and cultured at 28 °C in a peptone-yeast/malt extract medium augmented with 1.5% (w/v) D-glucose.

    • CsMBL1 coding sequence (CDS) was cloned and sequenced (Supplementary Table S1). This study acquired sequences from the CPBD database (http://citrus.hzau.edu.cn)[35,36]. Gene Structure Display Server (GSDS V2.0, http://gsds.gao-lab.org) was employed to predict gene structure[37]. Furthermore, functional domains were predicted using HMMER (http://hmmer.org)[38]. Moreover, MEGA X was utilized to construct a phylogenetic tree[39] using MBLs from different organisms (Supplementary Table S2).

    • To conduct exogenous hormone assays, leaf discs (with a diameter of 7 mm) were immersed in different hormones (10 μmol/L ABA, 100 μmol/L methyl jasmonate [MeJA], 10 μmol/L SA, 10 μmol/L ET), and then sampled at 0, 6, 12, and 24 h post-treatment (hpt).

    • The complete CDS of CsMBL1 was amplified using the following primers: FOEC-CsMBL1 (containing KpnI restriction site: GGTACCATGAAGATGTCATCTTCCTCAGC) and ROEC-CsMBL1 (containing 3 × flag tag and EcoRI restriction site sequence: GAATTCTTACTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTGTAATCCTTGTTGGGAGCCTTTATGA). The amplified sequence was then inserted into the pGLNe vector comprising the CaMV 35S promoter, which was then transformed into Agrobacterium tumefaciens EHA105. Furthermore, the segments of Wanjincheng's shoot were transformed according to the method of Peng[2]. Transgenic plants were confirmed by PCR and GUS staining, and thereafter assessed for CsMBL1 expression levels with qRT-PCR. Plants with empty vectors were set as controls.

    • The recombinant plasmid CsMBL1-EAQGFP was constructed based on the stop codon lacking CDSs of CsMBL1 using the following primer pair: FSC-CsMBL1 (containing homologous arms and an AgeI restriction site: CTGCCCAAATTCGCGACCGGTATGAAGATGTCATCTTCCTCAG), and RSC-CsMBL1 (containing homologous arms and an AgeI restriction site: TCCTTTGCTAGTCATACCGGTCTTGTTGGGAGCCTTTAT). Then, the fragments were cloned into the EAQGFP vector by following the protocol of the In-Fusion cloning kit (TaKaRa, Japan). Subsequently, the constructed plasmids were transfected into Nicotiana benthamiana protoplasts. After 12 h, the GFP signals were measured using a laser scanning confocal microscope (Olympus FV3000, Japan).

    • For VIGS fragment (Supplementary Table S1) amplification, the following primer pair was employed: FVIGS-CsMBL1 (containing homologous arms and an EcoRI restriction site: TTCTGTGAGTAAGGTTACCGAATTCGGTAAATTTATTTGGCAGAGTTTTGATTATCCA)/RVIGS-CsMBL1 (containing homologous arms and a BamHI restriction site: GACGCGTGAGCTCGGTACCGGATCCCGTGGGCCCCCAATCAA). The amplified region was incorporated into the TRV2 vector to produce TRV2-CsMBL1, and VIGS transformation was executed through infiltration with Agrobacterium tumefaciens EHA105[40]. After 30 d, Wanjincheng samples displayed green fluorescence under UV light, were pulverized in liquid nitrogen, and subsequently utilized for further analysis. The efficacy of VIGS silencing was assessed using qRT-PCR.

    • Mature CsMBL1 overexpressing leaves and VIGS plants were punctured 24 times (6 punctures/group). Then, each puncture site was injected with 1 µL of XccYN1 (1 × 108 CFU·mL−1), and leaves were placed on wet cotton at 28 °C for 10 d. The citrus canker disease on the leaves was assessed by evaluating the disease index (DI), and lesion area[2].

    • Total RNA was extracted using the RNA Mini Preparation Kit (Aidlab, China), and reverse transcribed into cDNA using the PrimeScript Kit (Takara, Japan), and a mixture of 1 µg RNA, 2 µL PrimeScript buffer, and RNase-free water (to a total volume of 10 µL). The reaction conditions were set as follows: 37 °C for 45 min, 85 °C for 5 s, and 4 °C for 5 min. The qRT-PCR thermal cycling program was as follows: pre-denaturation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 10 s, and 56 °C for 30 s. The reaction system (12 µL) contained cDNA (100 ng), primers (0.3 mmol/L), and PCR premix (6 µL). The relative gene expression was assessed via the 2−ΔΔCᴛ method[41]. The primers employed for qRT-PCR analysis were designed using the NCBI Primer BLAST tool and included: FRT-CsMBL1 (GAGAGTTCGGGCCATACGTT) and RRT-CsMBL1 (AACGCAAGCTGGAATGGAGA). The primers for reference gene, CsGAPDH (CPBD ID: Cs5g06870)[42,43], were FRT-GAPDH (GCTTTCCGTGTACCCACTGT) and RRT-GAPDH (CTCTGACTCCGCCTTGATGG). The C. sinensis mRNA sequence was used as a standard for primer specificity evaluation.

    • Hydrogen peroxide (H2O2) and superoxide radicals (O2) concentrations were measured using commercial kits (Suzhou Keming Biotechnology, China). Furthermore, the expression levels of JA, SA, and ABA were determined via UPLC-MS/MS, while ET concentration was measured using gas chromatography (GC). Peroxidase (POD), ascorbate peroxidase (APX), and respiratory burst oxidase homologs (RBOHs) activities were assessed using commercial kits (SinoBestBio, Shanghai, China).

    • Data were analyzed and visualized via GraphPad Prism V9.5 (San Diego, CA, USA), and depicted as means ± standard deviations (SDs). For intergroup comparison, a two-tailed t-test or Duncan's multiple range test followed by ANOVA was performed. p < 0.05 was considered statistically significant. qRT-PCR was performed in triplicate (n = 3).

    • CsMBL1 is present on chromosome 5 of sweet orange, and encodes a protein comprising 436 amino acids, with Bulb-type lectin, S-locus glycoprotein, and PAN domains. The CsMBL1 gene is 1,308 bp long and comprises a single exon (Fig. 1a). Phylogenetic analysis revealed that CsMBL1 is significantly associated with Poncirus trifoliata Ptrif.0003s1398.1.p. (Fig. 1b). The subcellular localization analysis revealed that CsMBL1 is primarily located in the nucleus (Fig. 1c).

      Figure 1. 

      Expression analysis and bioinformatics characterization of CsMBL1. (a) Chromosomal localization of CsMBL1 was identified using CPDB (internal reference), and its exon-intron structure was determined using GSDS V2.0. CsMBL1's functional domains were identified using HMMER. (b) MEGA X (bootstrap: 500, Poisson model) was employed to construct a maximum likelihood phylogenetic tree of CsMBL1 and its homologous proteins. Tree branches were proportional, with lengths representing the number of substitutions per site. Source species and protein IDs are indicated on the right side of the phylogenetic tree. (c) CsMBL1 had a subcellular localization in Nicotiana benthamiana protoplasts. Images show GFP (green fluorescent protein), mCherry (red fluorescent protein), bright field, and merged channels. Scale bar = 10 μm.

    • In plants, phytohormones generally modulate the expression of disease-related proteins[44]. To investigate the role of CsMBL1 in disease resistance signaling pathways, plants were treated with ABA, MeJA, SA, and ET, and then subjected to RT-PCR analysis to investigate CsMBL1 expression. After exogenous ABA treatment, CsMBL1 expression in both cultivars showed a consistent pattern of initial increase and then decrease (Fig. 2a). However, exogenous MeJA treatment induced contrasting CsMBL1 expression patterns, exhibiting considerable downregulation in Kumquat and pronounced overexpression in Wanjincheng (Fig. 2b). In Wanjincheng, SA treatment initially significantly decreased CsMBL1 expression, then increased, followed by a sharp decline at 24 h. Compared with Wanjincheng, CsMBL1 expression indicated a more gradual decline in Kumquat (Fig. 2c). Moreover, ET induction resulted in distinct temporal expression patterns of CsMBL1 between cultivars. In the Wanjincheng variety, CsMBL1 expression was significantly upregulated within the first 12 h post-ET-treatment, followed by a sharp decline by 24 h, whereas in the Kumquat variety, CsMBL1 expression was consistently elevated with no significant difference between 12 and 24 h timepoints (Fig. 2d). These results showed that CsMBL1 expression induces phytohormones, suggesting its functional involvement in certain hormone-mediated disease resistance signaling pathways.

      Figure 2. 

      Effects of phytohormone treatments on CsMBL1 expression in plants. qRT-PCR analysis of CsMBL1 expression in kumquat and Wanjincheng leaves following treatments with (a) ABA, (b) MeJA, (c) SA, (d) ET, and H2O (control). CsGAPDH (CPDB ID: Cs_ont_5g044290) was used as the internal reference gene. Statistical comparisons were performed using ANOVA with Duncan's multiple range test. WJC: Wanjincheng; JG: Kumquat.

    • In this study, a CsMBL1 overexpression plasmid was designed to assess its effects (Fig. 3a). The GUS staining indicated blue color on the leaf disc edge in three transgenic plants (PLGNe-CsMBL1-1, -2, -3), while no staining was observed in control plants (PLGNe) (Fig. 3b). PCR analysis detected the target fragment in the transgenic and positive control samples, but not in the control samples (Fig. 3c). Furthermore, qRT-PCR analysis validated CsMBL1 overexpression in transgenic plants (Fig. 3d). Moreover, transgenic plants had normal growth rates (Fig. 3e), and reduced citrus canker symptoms compared to controls (Fig. 3f). Similarly, the lesion disease and area index were reduced by 11.5%−18.8% and 10.6%−15.4%, respectively (Fig. 3g and h). These data revealed that CsMBL1 overexpression increases citrus canker resistance.

      Figure 3. 

      Effects of CsMBL1 overexpression on citrus canker resistance. (a) CsMBL1 overexpression vector. (b) GUS staining results. Blue staining indicates transgenic plants. (c) PCR validation of transgenic plants. M: DNA marker; +: pLGNe-CsMBL1 plasmid. (d) The expression of CsMBL1 relative to CsGAPDH. The control value was set to 1. Data are presented as mean ± SD of three replicates. (e) Phenotype of transgenic plants. (f) citrus canker symptoms in Xcc-infected leaves at 10 dpi. (g) Lesion disease, and (h) area index in CsMBL1-overexpressing plants at 10 dpi. (b)−(h) pLGNe-CsMBL1-1, -2, -3: CsMBL1-overexpressing materials, while pLGNe: control plants carrying the pLGNe vector. Data was statistically analyzed using Tukey's multiple range test (p < 0.05). NPTII: neomycin phosphotransferase II, NOS: NOS terminator, 35S: CaMV 35S promoter, GUS: β-glucuronidase and npt-linked coding gene, LB: left border, RB: right border, dpi: days post-infection.

    • To evaluate the role of CsMBL1 in citrus canker resistance, CsMBL1 was silenced in Wanjincheng plants. A CsMBL1 VIGS plasmid was constructed using the TRV2 vector (Fig. 4a). Furthermore, CsMBL1 silencing in VIGS plants was validated by PCR analysis using TRV1 and TRV2-specific primers (Fig. 4b). Compared to controls, VIGS plants had reduced relative expression of CsMBL1 (Fig. 4c). Moreover, Xcc-infected VIGS plants had more severe citrus canker symptoms relative to control plants (Fig. 4d). Further, the calculated lesion areas (1.25, 1.18, and 1.32) (Fig. 4e) and disease index values (1.23, 1.17, and 1.33) of plants TRV2-CsMBL1-1, TRV2-CsMBL1-2, and TRV2-CsMBL1-3 were higher than that of controls (Fig. 4f). These results indicate that silencing CsMBL1 reduces resistance to citrus canker.

      Figure 4. 

      Effect of CsMBL1 silencing on citrus canker resistance. (a) Plasmid used for VIGS. (b) Successful transformation of VIGS plants was confirmed by PCR. M indicates DNA Marker, "–" represents ddH2O, and "+" depicts plasmid. Primers used are shown on the left side of the gel electrophoresis image. (c) Relative CsMBL1 expression was assessed by qRT-PCR using CsGAPDH as a control. The control value was set to 1, and the data represent the average of three biological replicates. (d) Disease symptoms, (e) lesion area, and (f) disease index of Xcc-infected VIGS plants at 10 dpi. (b)–(f) TRV2-CsMBL1-1, -2, and -3: CsMBL1 VIGS plants; TRV2: control plants carrying the TRV2 vector (ANOVA with Tukey's multiple range test, p < 0.05). VIGS: virus-induced gene silencing (VIGS), 35S: Cauliflower mosaic virus 35S promoter, NOS: NOS terminator, GFP: green fluorescent protein, RdRp: RNA-dependent DNA polymerase, CP: coat protein, LB: left border, RB: right border.

    • In plants, ROS are the first line of defense against pathogens[45]. Furthermore, H2O2 and O2 serve as signaling molecules that regulate diverse cellular processes[46,47]. Here, it was observed that both H2O2 (Fig. 5a), and O2 (Fig. 5b) levels were increased in CsMBL1-overexpressing plants. RBOHs are primary producers of ROS in plants[48]. Moreover, POD and APX participate in ROS scavenging[49,50]. This study examined the activities of POD, RBOHs and APX, and revealed significant downregulation of POD activity (Fig. 5c), an evident increase in RBOH activity (Fig. 5d), while no significant difference in APX activity was observed compared to controls (Fig. 5e). These findings revealed that CsMBL1 overexpression increases ROS levels through the coordinated regulation of POD and RBOH activities, therefore increasing resistance to Xcc.

      Figure 5. 

      Effects of CsMBL1 overexpression on plant ROS levels. The contents of (a) H2O2, (b) O2, and activities of (c) POD, (d) RBOH, and (e) APX were measured in CsMBL1-overexpressing plants. PLGNe-CsMBL1-1/-2: CsMBL1-overexpressing transgenic lines, PLGNe: Control plants carrying the empty PLGNe vector. Data were analyzed by ANOVA with Tukey's multiple range test, p < 0.05.

    • Phytohormones, including SA, JA, ABA, and ET, have been found to essentially modulate plant immunity[5153]. To identify whether these hormones participate in CsMBL1 overexpression-mediated resistance, PLGNe-CsMBL1-2 transgenic plants with superior resistance were selected to assess phytohormone levels. It was observed that CsMBL1 overexpression significantly reduced ABA and JA levels (Fig. 6a and b), while increasing SA accumulation (Fig. 6c). There were no significant changes in ET content (Fig. 6d). These data suggest that CsMBL1 overexpression increases citrus canker resistance in Wanjincheng by modulating hormone homeostasis, decreasing JA and ABA levels while increasing SA accumulation.

      Figure 6. 

      Effects of CsMBL1 overexpression on phytohormone levels. Concentrations of (a) ABA, (b) JA, (c) SA, and (d) ET were measured in CsMBL1-overexpressing plants. In (a)−(d): PLGNe-CsMBL1-2: CsMBL1-overexpressing plants. PLGNe: Control plants with an empty PLGNe vector. Data were statistically analyzed by ANOVA with Tukey's multiple range test (p < 0.05).

    • The citrus canker is a destructive plant disease caused by Xcc and significantly adversely affects global citrus production[54]. Lectins are natural bioactive proteins with unique carbohydrate-binding abilities. Furthermore, they have indicated antibacterial properties and facilitate immune responses[55]. Mannose-binding B-lectins specifically recognize mannose and function in innate immunity. The anti-pathogenic activity of MBLs has been observed in various species, including Arabidopsis, pepper, orchid, rice, and strawberry[18,20,56,57]. To evaluate whether citrus MBLs confer citrus canker resistance, CsMBL1, a citrus canker-induced gene encoding a B-lectin, was analyzed. Based on the transcriptome data, we identified and functionally characterized the differentially expressed gene CsMBL1. The data showed that CsMBL1 overexpression alleviated canker symptoms, whereas VIGS exacerbated disease severity, suggesting that CsMBL1 positively regulates citrus canker resistance.

      The ROS signaling plays a pivotal role in plant innate immunity[58], and its accumulation promotes a plant adaptive response to stress conditions[46]. In sweet orange, the CsAP2-09-CsWRKY25-CsRBOH2 cascade confers Xcc resistance by modulating ROS homeostasis[27]. In rice, OsCERK1 downregulation inhibits the formation of ROS generated by LPS, which is a principal microbe-associated molecular pattern (MAMP) recognized by both plants and animals[17]. Here, it was found that CsMBL1-overexpressing plants had elevated H2O2 and O2 levels, as well as decreased POD and enhanced RBOHs activities. This ROS accumulation constitutes the fundamental plant defense mechanism[59], demonstrating that CsMBL1 mediates citrus canker resistance via ROS production.

      Phytohormones, such as ABA, SA, JA, and ET, regulate plant defense mechanisms against biotic and abiotic stressors[60]. It has been observed that SA significantly regulates hypersensitive response and systemic acquired resistance[61], while ABA antagonizes defense-related hormones[62]. Moreover, JA and ET jointly modulate Botrytis cinerea-induced systemic resistance[63]. Furthermore, the relationship between ABA, SA, JA, ET, and resistance to citrus canker is well-documented in the literature[34,54,64]. In this study, the hormonal analyses revealed that CsMBL1 positively regulates SA while negatively affecting JA and ABA levels. MBLs are considered the regulators of the SA/JA pathways. For example, the overexpression of pepper CaMBL1 stimulates the production of defense genes and the formation of SA to counteract Xanthomonas campestris pv vesicatoria (Xcv) infection[20]. Moreover, Arabidopsis AtLEC is involved in JA/ET/chitin-triggered defenses[65], and strawberry FaMBL1 overexpression decreases JA content[57].

      These findings indicate that CsMBL1 acts as a modulator of ABA, JA, SA, and ROS homeostasis, thus increasing citrus canker resistance. Furthermore, CsMBL1 expression is inducible by MeJA in Wanjincheng; however, its overexpression inhibits JA levels, indicating a self-regulatory loop that may modulate JA-mediated defenses. However, the present study on CsMBL1 remains insufficiently comprehensive. The relationships between CsMBL1 and phytohormones, ROS, and other signaling molecules require further investigation. Subsequent research could identify CsMBL1-interacting proteins and examine the expression of downstream defense-related genes to refine the regulatory network. These efforts would provide additional data to support the role of CsMBL1 in resistance against citrus bacterial canker. Additionally, Xcc-induced gene expression experiments can be conducted in both the citrus canker-resistant variety Kumquat (C. japonica), and citrus canker-susceptible variety Wanjincheng (C. sinensis). This would allow for the construction of a hypothetical model that integrates cultivar-specific data and functional data to explain the enhanced resistance to CBC observed in Kumquat and in CsMBL1-overexpressing 'Wanjincheng' plants.

    • In summary, this study demonstrated that CsMBL1 increases citrus canker resistance by coordinated regulation of defense components: (1) upregulating CsMBL1 expression; (2) increasing SA and ROS (via RBOHs activation/POD suppression); and (3) reducing ABA/JA levels. Therefore, CsMBL1, as a positive regulator of citrus canker resistance, serves as a prospective molecular target for the development of canker-resistant citrus cultivars.

      • This study was funded by the National Key Research and Development Program of China (2022YFD1201600), National Natural Science Foundation of China (32472682, 32502634), National Natural Science Foundation of Chongqing (CSTB2025NSCQ-GPX0540), Earmarked Funds for the China Agriculture Research System (CARS-26) and Fundamental Research Funds for the Central Universities (SWU-XDJH202308).

      • The authors confirm their contributions to the paper as follows: designed the experiments: Li Q; performed the experiments: Li M, Song Q, Lin D, Zhang M; analyzed the data: Li M, Song Q, Li Q, He Y; wrote the article: Li M, Li Q, He Y. All authors reviewed the results and approved the final version of the manuscript.

      • The authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials.

      • The authors declare that they have no conflict of interest.

      • # Authors contributed equally: Man Li, Qingwei Song

      • Copyright: © 2026 by the author(s). Published by Maximum Academic Press on behalf of Chongqing University. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (6)  References (65)
  • About this article
    Cite this article
    Li M, Song Q, Lin D, Zhang M, He Y, et al. 2026. The mannose-binding lectin gene CsMBL1 positively regulates resistance to citrus canker. Plant Hormones 2: e001 doi: 10.48130/ph-0025-0028
    Li M, Song Q, Lin D, Zhang M, He Y, et al. 2026. The mannose-binding lectin gene CsMBL1 positively regulates resistance to citrus canker. Plant Hormones 2: e001 doi: 10.48130/ph-0025-0028

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return