Search
2026 Volume 6
Article Contents
ARTICLE   Open Access    

Genome-wide identification of the CIPK gene family in lettuce and expression analysis under salt and drought stress

  • # Authors contributed equally: Jiawei Li, Zixuan Li, Ke Li

More Information
  • Received: 13 December 2025
    Revised: 22 January 2026
    Accepted: 04 February 2026
    Published online: 31 March 2026
    Vegetable Research  6 Article number: e012 (2026)  |  Cite this article
  • CBL-interacting protein kinases (CIPKs) serve as key regulators in plant Ca2+ signaling pathways, playing a vital role in responding to abiotic stresses such as salinity and drought. However, systematic studies on the CIPK gene family in lettuce (Lactuca sativa L.) remain scarce. In this study, comprehensive identification, structural analysis, evolutionary analysis, and stress response analysis of the CIPK gene family were conducted based on the lettuce reference genome. A total of 32 LsCIPK genes were identified, which were distributed on nine chromosomes. Phylogenetic analysis demonstrated that 32 LsCIPKs could be divided into five evolutionary branches. All LsCIPK proteins contained a typical protein kinase domain and an NAF domain (CBL-interacting domain). Promoter cis-element analysis indicated that most LsCIPK genes are rich in cis-elements associated with light response, hormone response, and abiotic stress. Collinearity analysis indicates that the expansion of this gene family was primarily driven by segmental duplication, and the Ka/Ks ratios for all eight duplicate gene pairs were less than 1, suggesting that the family as a whole is under purifying selection. Expression analysis revealed significant expression changes in multiple LsCIPK genes. Among them, the expression of LsCIPK7, LsCIPK26, and LsCIPK32 was strongly induced. Further qRT-PCR results confirmed the transcriptome trends. Subcellular localization analysis of LsCIPK32 revealed that this protein is primarily distributed in the nucleus and cell membrane. This study provides candidate genes and theoretical support for deciphering the regulatory mechanisms of the lettuce CBL-CIPK signaling pathway and for breeding salt-tolerant and drought-resistant lettuce varieties.
  • 加载中
  • [1] Bihani SC, Tarushi, Srivastava AK. 2025. Decoding the calcium signal: structural insights into CBL-CIPK pathway in plants. Biochimica et Biophysica Acta (BBA) − General Subjects 1869:130819 doi: 10.1016/j.bbagen.2025.130819

    CrossRef   Google Scholar

    [2] Ma X, Li QH, Yu YN, Qiao YM, Haq SU, et al. 2020. The CBL-CIPK pathway in plant response to stress signals. International Journal of Molecular Sciences 21:5668 doi: 10.3390/ijms21165668

    CrossRef   Google Scholar

    [3] Kaya C, Uğurlar F, Adamakis IS. 2024. Molecular mechanisms of CBL-CIPK signaling pathway in plant abiotic stress tolerance and hormone crosstalk. International Journal of Molecular Sciences 25:5043 doi: 10.3390/ijms25095043

    CrossRef   Google Scholar

    [4] Plasencia FA, Estrada Y, Flores FB, Ortíz-Atienza A, Lozano R, et al. 2021. The Ca2+ sensor calcineurin B-like protein 10 in plants: emerging new crucial roles for plant abiotic stress tolerance. Frontiers in Plant Science 11:599944 doi: 10.3389/fpls.2020.599944

    CrossRef   Google Scholar

    [5] Dong Q, Bai B, Almutairi BO, Kudla J. 2021. Emerging roles of the CBL-CIPK calcium signaling network as key regulatory hub in plant nutrition. Journal of Plant Physiology 257:153335 doi: 10.1016/j.jplph.2020.153335

    CrossRef   Google Scholar

    [6] Gong Z, Xiong L, Shi H, Yang S, Herrera-Estrella LR, et al. 2020. Plant abiotic stress response and nutrient use efficiency. Science China Life Sciences 63:635−674 doi: 10.1007/s11427-020-1683-x

    CrossRef   Google Scholar

    [7] Poddar N, Deepika D, Chitkara P, Singh A, Kumar S. 2022. Molecular and expression analysis indicate the role of CBL interacting protein kinases (CIPKs) in abiotic stress signaling and development in chickpea. Scientific Reports 12:16862 doi: 10.1038/s41598-022-20750-2

    CrossRef   Google Scholar

    [8] Chen Y, Jin YF, Wang Y, Gao Y, Wang Q, et al. 2022. Diverse roles of the CIPK gene family in transcription regulation and various biotic and abiotic stresses: a literature review and bibliometric study. Frontiers in Genetics 13:1041078 doi: 10.3389/fgene.2022.1041078

    CrossRef   Google Scholar

    [9] Wang C, Huang Q, Gu J, Cai M, Lei Z, et al. 2026. Genome-wide identification of the CIPK family in sunflower (Helianthus annuus L.) and functional analysis of HaCIPK18 in salt tolerance. Plant Science 362:112846 doi: 10.1016/j.plantsci.2025.112846

    CrossRef   Google Scholar

    [10] Zhou Y, Zhu Y, Li W, Zhang T, Li Y, et al. 2023. Heterologous expression of Sesuvium portulacastrum SOS-related genes confer salt tolerance in yeast. Acta Physiologiae Plantarum 45(4):58 doi: 10.1007/s11738-023-03518-7

    CrossRef   Google Scholar

    [11] Hu DG, Ma QJ, Sun CH, Sun MH, You CX, et al. 2016. Overexpression of MdSOS2L1, a CIPK protein kinase, increases the antioxidant metabolites to enhance salt tolerance in apple and tomato. Physiologia Plantarum 156:201−214 doi: 10.1111/ppl.12354

    CrossRef   Google Scholar

    [12] Tansley C, Houghton J, Rose AME, Witek B, Payet RD, et al. 2023. CIPK-B is essential for salt stress signalling in Marchantia polymorpha. New Phytologist 237:2210−2223 doi: 10.1111/nph.18633

    CrossRef   Google Scholar

    [13] Wang M, Yang S, Sun L, Feng Z, Gao Y, et al. 2022. A CBL4-CIPK6 module confers salt tolerance in cucumber. Vegetable Research 2:7 doi: 10.48130/vr-2022-0007

    CrossRef   Google Scholar

    [14] Imtiaz K, Ahmed M, Annum N, Tester M, Saeed NA. 2023. AtCIPK16, a CBL-interacting protein kinase gene, confers salinity tolerance in transgenic wheat. Frontiers in Plant Science 14:1127311 doi: 10.3389/fpls.2023.1127311

    CrossRef   Google Scholar

    [15] Jakada BH, Zhu F, Waqas K, Chen H, Guan Q, et al. 2025. The CBL-interacting protein kinase 9 (OsCIPK9) contributes to saline-alkali stress tolerance in rice. Plant Physiology and Biochemistry 229:110332 doi: 10.1016/j.plaphy.2025.110332

    CrossRef   Google Scholar

    [16] Lu L, Chen X, Wang P, Lu Y, Zhang J, et al. 2021. CIPK11: a calcineurin B-like protein-interacting protein kinase from Nitraria tangutorum, confers tolerance to salt and drought in Arabidopsis. BMC Plant Biology 21:123 doi: 10.1186/s12870-021-02878-x

    CrossRef   Google Scholar

    [17] Hu W, Xia Z, Yan Y, Ding Z, Tie W, et al. Genome-wide gene phylogeny of CIPK family in cassava and expression analysis of partial drought-induced genes. Frontiers in Plant Science 6:914 doi: 10.3389/fpls.2015.00914

    CrossRef   Google Scholar

    [18] Sanyal SK, Sharma K, Bisht D, Sharma S, Sushmita K, et al. 2023. Role of calcium sensor protein module CBL-CIPK in abiotic stress and light signaling responses in green algae. International Journal of Biological Macromolecules 237:124163 doi: 10.1016/j.ijbiomac.2023.124163

    CrossRef   Google Scholar

    [19] You Z, Guo S, Li Q, Fang Y, Huang P, et al. 2023. The CBL1/9-CIPK1 calcium sensor negatively regulates drought stress by phosphorylating the PYLs ABA receptor. Nature Communications 14:5886 doi: 10.1038/s41467-023-41657-0

    CrossRef   Google Scholar

    [20] Zhu X, Wang B, Wang X, Wei X. 2022. Identification of the CIPK-CBL family gene and functional characterization of CqCIPK14 gene under drought stress in quinoa. BMC Genomics 23:447 doi: 10.1186/s12864-022-08683-6

    CrossRef   Google Scholar

    [21] Lu S, Chen Y, Wang S, Han B, Zhao C, et al. 2023. Combined metabolomic and transcriptomic analysis reveals key components of OsCIPK17 overexpression improves drought tolerance in rice. Frontiers in Plant Science 13:1043757 doi: 10.3389/fpls.2022.1043757

    CrossRef   Google Scholar

    [22] Ma X, Yu YN, Li Y, Gong ZH. 2023. The CBL-interacting protein kinase CaCIPK7 enhances drought resistance in pepper. Scientia Horticulturae 310:111726 doi: 10.1016/j.scienta.2022.111726

    CrossRef   Google Scholar

    [23] Hosseini Pouya HS, Cheniany M, Heidari, P. 2025. Decoding the CBL gene family in durum wheat: insights into dual ABA signaling pathways and calcium-mediated drought tolerance. The Plant Genome 18:e70062 doi: 10.1002/tpg2.70062

    CrossRef   Google Scholar

    [24] Shi J, Kim KN, Ritz O, Albrecht V, Gupta R, et al. 1999. Novel protein kinases associated with calcineurin B-like calcium sensors in Arabidopsis. The Plant Cell 11:2393−2405 doi: 10.2307/3870963

    CrossRef   Google Scholar

    [25] Xiang Y, Huang Y, Xiong L. 2007. Characterization of stress-responsive CIPK genes in rice for stress tolerance improvement. Plant Physiology 144:1416−1428 doi: 10.1104/pp.107.101295

    CrossRef   Google Scholar

    [26] Wang Q, Zhao K, Gong Y, Yang Y, Yue Y. 2022. Genome-wide identification and functional analysis of the calcineurin B-like protein and calcineurin B-like Protein-interacting protein kinase gene families in Chinese cabbage (Brassica rapa ssp. pekinensis). Genes 13:795 doi: 10.3390/genes13050795

    CrossRef   Google Scholar

    [27] Cui Y, Su Y, Wang J, Jia B, Wu M, et al. 2020. Genome-wide characterization and analysis of CIPK gene family in two cultivated allopolyploid cotton species: sequence variation, association with Seed oil content, and the role of GhCIPK6. International Journal of Molecular Sciences 21:863 doi: 10.3390/ijms21030863

    CrossRef   Google Scholar

    [28] Xi Y, Liu J, Dong C, Cheng ZM. 2017. The CBL and CIPK gene family in grapevine (Vitis vinifera): genome-wide analysis and expression profiles in response to various abiotic stresses. Frontiers in Plant Science 8:978 doi: 10.3389/fpls.2017.00978

    CrossRef   Google Scholar

    [29] Zhang Y, Zhou XN, Liu S, Yu A, Yang C, et al. 2020. Identification and functional analysis of tomato CIPK gene family. International Journal of Molecular Science 21:110 doi: 10.3390/ijms21010110

    CrossRef   Google Scholar

    [30] Ma R, Liu W, Li S, Zhu X, Yang J, et al. 2021. Genome-wide identification, characterization and expression analysis of the CIPK gene family in potato (Solanum tuberosum L.) and the role of StCIPK10 in response to drought and osmotic stress. International Journal of Molecular Sciences 22:13535 doi: 10.3390/ijms222413535

    CrossRef   Google Scholar

    [31] Ma X, Gai WX, Qiao YM, Ali M, Wei AM, et al. 2019. Identification of CBL and CIPK gene families and functional characterization of CaCIPK1 under Phytophthora capsici in pepper (Capsicum annuum L.). BMC Genomics 20:775 doi: 10.1186/s12864-019-6125-z

    CrossRef   Google Scholar

    [32] Yin X, Wang Q, Chen Q, Xiang N, Yang Y, et al. 2017. Genome-wide identification and functional analysis of the calcineurin B-like protein and calcineurin B-like protein-interacting protein kinase gene families in turnip (Brassica rapa var. rapa). Frontiers in Plant Science 8:1191 doi: 10.3389/fpls.2017.01191

    CrossRef   Google Scholar

    [33] Zhu K, Fan P, Liu H, Tan P, Ma W, et al. 2022. Insight into the CBL and CIPK gene families in pecan (Carya illinoinensis): identification, evolution and expression patterns in drought response. BMC Plant Biology 22:221 doi: 10.1186/s12870-022-03601-0

    CrossRef   Google Scholar

    [34] Narwal P, Singh RK, Pathak AK, Kumar D, Negi NP. 2024. Genome-wide profiling of CBL interacting protein kinases (CIPKs) in banana unveils their role in abiotic stress signaling and stress tolerance enhancement. Plant Stress 11:100417 doi: 10.1016/j.stress.2024.100417

    CrossRef   Google Scholar

    [35] Alemu TT, Oanh VTK. 2025. Implications of developmental levels and packaging materials on the quality of iceberg lettuce for marketing system: a review. International Journal of Food Science 2025:5548305 doi: 10.1155/ijfo/5548305

    CrossRef   Google Scholar

    [36] Abdelkader M, Suliman AA, Salem SS, Assiya A, Voronina L, et al. 2024. Studying the combined impact of salinity and drought stress-simulated conditions on physio-biochemical characteristics of lettuce plant. Horticulturae 10:1186 doi: 10.3390/horticulturae10111186

    CrossRef   Google Scholar

    [37] Reyes-Chin-Wo S, Wang Z, Yang X, Kozik A, Arikit S, et al. 2017. Genome assembly with in vitro proximity ligation data and whole-genome triplication in lettuce. Nature Communications 8:14953 doi: 10.1038/ncomms14953

    CrossRef   Google Scholar

    [38] Cao S, Sawettalake N, Shen L. 2024. Gapless genome assembly and epigenetic profiles reveal gene regulation of whole-genome triplication in lettuce. GigaScience 13:giae043 doi: 10.1093/gigascience/giae043

    CrossRef   Google Scholar

    [39] Wang K, Jin J, Wang J, Wang X, Sun J, et al. 2024. The complete telomere-to-telomere genome assembly of lettuce. Plant Communications 5:101011 doi: 10.1016/j.xplc.2024.101011

    CrossRef   Google Scholar

    [40] Zhang B, Xue Y, Liu X, Ding H, Yang Y, et al. 2024. A near-complete chromosome-level genome assembly of looseleaf lettuce (Lactuca sativa var. crispa). Scientific Data 11:961 doi: 10.1038/s41597-024-03830-y

    CrossRef   Google Scholar

    [41] van Workum DM, Mehrem SL, Snoek BL, Alderkamp MC, Lapin D, et al. 2024. Lactuca super-pangenome reduces bias towards reference genes in lettuce research. BMC Plant Biology 24:1019 doi: 10.1186/s12870-024-05712-2

    CrossRef   Google Scholar

    [42] Finn RD, Clements J, Eddy SR. 2011. HMMER web server: interactive sequence similarity searching. Nucleic Acids Research 39:W29−W37 doi: 10.1093/nar/gkr367

    CrossRef   Google Scholar

    [43] Kumar S, Stecher G, Tamura K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33:1870−1874 doi: 10.1093/molbev/msw054

    CrossRef   Google Scholar

    [44] Bailey TL, Boden M, Buske FA, Frith M, Grant CE, et al. MEME SUITE: tools for motif discovery and searching. Nucleic Acids Research 37:W202−W208 doi: 10.1093/nar/gkp335

    CrossRef   Google Scholar

    [45] Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, et al. 2020. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Molecular Plant 13:1194−1202 doi: 10.1016/j.molp.2020.06.009

    CrossRef   Google Scholar

    [46] Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, et al. 2003. ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Research 31:3784−3788 doi: 10.1093/nar/gkg563

    CrossRef   Google Scholar

    [47] Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, et al. 2002. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Research 30:325−327 doi: 10.1093/nar/30.1.325

    CrossRef   Google Scholar

    [48] Wang Y, Li J, Paterson AH. 2013. MCScanX-transposed: detecting transposed gene duplications based on multiple colinearity scans. Bioinformatics 29:1458−1460 doi: 10.1093/bioinformatics/btt150

    CrossRef   Google Scholar

    [49] Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative CT method. Nature Protocols 3:1101−1108 doi: 10.1038/nprot.2008.73

    CrossRef   Google Scholar

    [50] Chen JS, Wang ST, Mei Q, Sun T, Hu JT, et al. The role of CBL-CIPK signaling in plant responses to biotic and abiotic stresses. Plant Molecular Biology 114:53 doi: 10.1007/s11103-024-01417-0

    CrossRef   Google Scholar

  • Cite this article

    Li J, Li Z, Li K, Chu W, Zhao Q, et al. 2026. Genome-wide identification of the CIPK gene family in lettuce and expression analysis under salt and drought stress. Vegetable Research 6: e012 doi: 10.48130/vegres-0026-0005
    Li J, Li Z, Li K, Chu W, Zhao Q, et al. 2026. Genome-wide identification of the CIPK gene family in lettuce and expression analysis under salt and drought stress. Vegetable Research 6: e012 doi: 10.48130/vegres-0026-0005

Figures(14)  /  Tables(2)

Article Metrics

Article views(87) PDF downloads(26)

ARTICLE   Open Access    

Genome-wide identification of the CIPK gene family in lettuce and expression analysis under salt and drought stress

Vegetable Research  6 Article number: e012  (2026)  |  Cite this article

Abstract: CBL-interacting protein kinases (CIPKs) serve as key regulators in plant Ca2+ signaling pathways, playing a vital role in responding to abiotic stresses such as salinity and drought. However, systematic studies on the CIPK gene family in lettuce (Lactuca sativa L.) remain scarce. In this study, comprehensive identification, structural analysis, evolutionary analysis, and stress response analysis of the CIPK gene family were conducted based on the lettuce reference genome. A total of 32 LsCIPK genes were identified, which were distributed on nine chromosomes. Phylogenetic analysis demonstrated that 32 LsCIPKs could be divided into five evolutionary branches. All LsCIPK proteins contained a typical protein kinase domain and an NAF domain (CBL-interacting domain). Promoter cis-element analysis indicated that most LsCIPK genes are rich in cis-elements associated with light response, hormone response, and abiotic stress. Collinearity analysis indicates that the expansion of this gene family was primarily driven by segmental duplication, and the Ka/Ks ratios for all eight duplicate gene pairs were less than 1, suggesting that the family as a whole is under purifying selection. Expression analysis revealed significant expression changes in multiple LsCIPK genes. Among them, the expression of LsCIPK7, LsCIPK26, and LsCIPK32 was strongly induced. Further qRT-PCR results confirmed the transcriptome trends. Subcellular localization analysis of LsCIPK32 revealed that this protein is primarily distributed in the nucleus and cell membrane. This study provides candidate genes and theoretical support for deciphering the regulatory mechanisms of the lettuce CBL-CIPK signaling pathway and for breeding salt-tolerant and drought-resistant lettuce varieties.

    • Plants frequently encounter various abiotic stresses, such as salt accumulation, drought, and environmental fluctuations such as high and low temperatures. These stresses severely impact crop growth and development, photosynthetic efficiency, and yield; thus, improving crop adaptability under adverse conditions has become a critical goal for sustainable agricultural development[1]. As a widely distributed intracellular second messenger, calcium ions (Ca2+) play a crucial role in plants' responses to these stresses[2]. Transient changes in Ca2+ levels form specific calcium signatures, providing a precise signal encoding basis for downstream sensing systems and triggering a series of complex physiological responses and gene expression adjustments[3]. Plants possess multiple types of Ca2+ sensors, including calmodulin (CaM/CML), calcium-dependent protein kinases (CDPKs), and the CBL-CIPK signaling system. CBL (calcineurin B-like proteins), acting as Ca2+ sensors, interact with CIPKs (serine/threonine protein kinases) to form CBL-CIPK complexes. By regulating various transporters and signaling modules, they participate in responses to abiotic stresses such as salinity, drought, and low temperatures[4]. CIPK, as a downstream target of CBL, undergoes specific interaction with CBL mediated by Ca2+ to form a complex, thereby participating in regulating plant responses to various environmental stimuli. CIPK acts as a key intermediary, bridging Ca2+ sensors and their downstream targets, playing a pivotal role in various protein-protein interactions[5]. Research has revealed that CIPK functions by interacting specifically with one or more CBL proteins, thereby participating in the regulation of plant responses to various abiotic stresses such as drought, salinity, low temperatures, and heavy metals[6].

      In plants, CIPK plays a key role in salt stress responses by interacting with CBL (Calcineurin B-like) proteins. CBL proteins act as calcium sensors. When plants undergo salt stress, intracellular calcium concentrations undergo transient changes. Upon detecting these calcium signals, CBL proteins bind to CIPK proteins, thereby activating their kinase activity. Activated CIPK proteins can phosphorylate downstream target proteins, regulating plant physiological and biochemical processes to help plants adapt to salt stress[7]. In Arabidopsis, AtCIPK24 (also known as SOS2) interacts with CBL4 (SOS3) to phosphorylate the SOS1 protein, which is a Na+/H+ counter-transport pump located on the cell membrane[8]. By phosphorylating SOS1, the AtCIPK24/CBL4 complex enhances SOS1 activity, promoting the efflux of excess sodium ions from cells and thereby improving plant salt tolerance[9]. During heterologous expression experiments in yeast, it was discovered that SpCIPK8 from Sesuvium portulacastrum forms a complex with SpCBL10. This complex regulates the activity of the plasma membrane Na+/H+ counter-transporter by recognizing and binding to the C-terminal segment of SpSOS1, targeting specific amino acid residues (Ser1144 and Ser1146)[10]. Overexpression of MdSOS2L1 in apple exhibited significantly increased levels of antioxidants such as anthocyanins and malic acid, while also demonstrating enhanced salt tolerance[11]. In liverwort (Marchantia polymorpha), knockout mutants of MpCIPK-B exhibited leaf yellowing and even wilting under salt stress conditions[12]. CsCBL4 and CsCIPK6 were found to specifically interact in cucumber (Cucumis sativus), jointly responding to salt stress, with their silencing reducing salt tolerance[13]. In Arabidopsis, AtCIPK16 is significantly upregulated under salt stress conditions, suggesting its involvement in salt response pathways[14]. In rice, OsCIPK9 has been demonstrated to be a key regulatory factor for salt-alkali stress tolerance, with inactivating mutant lines exhibiting enhanced stress resistance[15]. Additionally, heterologous expression of the algal-derived CIPK (NtCIPK11) promoted proline accumulation in transgenic tobacco plants, thereby enhancing tolerance under salt stress[16]. Similarly, CIPK proteins play a critical role in drought stress responses through interactions with CBL proteins, which act as calcium sensors, binding to CIPK proteins upon detecting calcium signals during stress. When plants undergo drought stress, intracellular calcium concentrations surge transiently. Upon detecting these calcium signals, CBL proteins bind to CIPK proteins, thereby activating their kinase activity[17]. Activated CIPK proteins can phosphorylate downstream target proteins, regulating plant physiological and biochemical processes to help plants adapt to drought stress[18]. In Arabidopsis, AtCIPK1 negatively regulates ABA signaling in drought responses by phosphorylating the ABA receptor PYL4, thereby achieving negative feedback regulation of the drought response system[19]. In quinoa, most CqCIPK genes showed significant upregulation in roots and leaves following drought stress (6 h), with CqCIPK01 and CqCIPK25 exhibiting expression increases of 77- and 138-fold, respectively[20]. In rice, OsCIPK17 positively regulates drought responses through mechanisms that include promoting citrate accumulation in the TCA cycle, thereby enhancing root development and energy metabolism[21]. In chili peppers, CaCIPK7 participates in drought tolerance responses through ROS scavenging and the ABA signaling pathway, significantly enhancing drought resistance[22]. Analysis of multiple TtCIPK gene families in durum wheat revealed that TtCIPK33 is a candidate gene highly involved in drought response, potentially contributing to enhanced drought tolerance[23].

      In Arabidopsis thaliana, a CIPK protein kinase gene, AtCIPK, was identified in higher plants for the first time[24]. With the rapid advancement of high-throughput genome sequencing, CIPK and CBL genes have been systematically analyzed in numerous species. The OsCIPK family was systematically annotated at the whole-genome level in rice (Oryza sativa), and sequence and expression analyses revealed its vital role in stress responses[25]. In Chinese cabbage (Brassica rapa ssp. pekinensis), 18 CBLs and 47 CIPKs were analyzed respectively[26]. Besides, 80 and 78 CIPK genes were identified in upland cotton (Gossypium hirsutum) and sea island cotton (G. barbadense), respectively[27]. Eight CBL and 20 CIPK genes were analyzed in the grapevine (Vitis vinifera) genome and classified into subgroups based on phylogenetic and structural characteristics[28]. In tomato (Solanum lycopersicum), 22 SlCIPK genes were identified and combined with expression analysis, pointed to their functions related to abiotic stress[29]. Twenty-seven StCIPK genes were identified in potato (Solanum tuberosum), categorized into 'few/many introns' based on gene structure, with some genes associated with drought/ABA induction[30]. In pepper (Capsicum annuum), nine CaCBL and 26 CaCIPK genes were identified, most of which showed significant expression changes under salt/osmotic stress and pathogen stress[31]. Nineteen CBLs and 51 CIPKs were identified in Turnip (Brassica rapa var. rapa), with family expansion closely associated with segmental duplication (a type of gene duplication involving large chromosomal segments)[32]. An integrated comparison of hickory (Carya illinoinensis) with other species, highlights the diversity in CBL/CIPK family members and functional variations, serving as one of the representative data sources for woody fruit trees[33]. In bananas (Musa spp.), 34 CIPK members were identified and characterized, filling an information gap regarding this crop at the CIPK family level[34]. These findings collectively highlight the evolutionary diversity and functional specialization of CIPK-CBL signaling across plant species.

      Lettuce (Lactuca sativa L.), belonging to the Asteraceae family, is one of the most widely cultivated leafy vegetables globally. It holds significant economic value and serves as an important source of natural plant nutrients in the human diet[35]. The completion of high-quality reference genomes has enabled rigorous gene family analysis. Lettuce is primarily a cold-tolerant annual crop suited for low-temperature growth, yet it is highly sensitive to high temperatures, salt stress, and drought. These abiotic stresses significantly impact its quality and yield[36]. The chromosome-level assembly of cv. Salinas was first reported in 2017, followed by improved gap-free or telomere-to-telomere assemblies and additional morphotype-specific genomes. Recently, the lettuce super-pan-genome, which expanded the catalog of presence-absence and structural variants associated with traits and stress adaptation[3741]. Despite these genomic resources, the CIPK gene family in lettuce remains unexplored. While extensive research has been conducted on lettuce morphology, cultivation management, stress physiology, and nutritional quality, systematic bioinformatics analyses of lettuce gene families are still limited. With the completion of lettuce whole-genome sequencing, extensive genomic data has enabled comprehensive identification of its gene families. This study aims to systematically identify and analyze the CIPK gene family in lettuce using bioinformatics methods, including phylogenetic relationships, gene structural features, and prediction of promoter cis-acting elements. Simultaneously, transcriptomic and gene expression analyses under salt and drought stress conditions revealed that multiple LsCIPK genes (e.g., LsCIPK7, LsCIPK26, and LsCIPK32) are strongly induced, suggesting their potential roles in abiotic stress responses. This study provides candidate genes and theoretical support for deciphering the regulatory mechanisms of the CBL-CIPK signaling pathways in lettuce and breeding salt-tolerant and drought-tolerant lettuce varieties.

    • Seeds of the uniform and plump lettuce (Lactuca sativa L.) cultivar 'American Fast-Grower' (Institute of Vegetable and Flower Crops, Chinese Academy of Agricultural Sciences, Beijing, China) were selected for subculture propagation. The culture medium was based on MS medium supplemented with 0.5 mg/L 6-BA, and 0.1 mg/L NAA. Meanwhile, 30 g sucrose and 7 g agar were added per L of medium, adjusting the pH to 5.8−6.2. Culture conditions are set at 25 °C with a 16-h light/8-h dark photoperiod at an irradiance of 200 μmol/m2/s. Subculture was performed every 30 d. Subsequently, robust and uniformly developed tissue-cultured seedlings, four weeks old, were selected and treated with 20% PEG6000 and 200 mM NaCl, respectively. After 24 h, apical young leaves from the control (CK) and both stressed groups were collected and frozen immediately in liquid nitrogen, and then stored at −80 °C. Total RNA was extracted using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme, Nanjing, China). cDNA synthesis was performed with the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, Nanjing, China).

    • The lettuce genome and protein sequences were downloaded from the NCBI database (www.ncbi.nlm.nih.gov), and the hidden Markov model (HMM, Pfam: PF03822) was obtained from the Pfam database (http://pfam.xfam.org). Additionally, the protein kinase domain (PF00069) was referenced to assist in the screening process. Arabidopsis and rice CIPK protein sequences were used as query sequences, and BLASTP alignment was performed against the local lettuce protein database (E-value set to 1e-10) to obtain preliminary candidate proteins. Subsequently, the hmmsearch program of HMMER was performed to further screen the candidate sequences based on PF03822[42]. Following domain identification and validation using Pfam and NCBI-CDD databases, the lettuce CIPK gene family members were definitively determined. The gene IDs were then extracted from the lettuce genome annotation files for further analysis.

    • To elucidate the evolutionary relationship between the lettuce and Arabidopsis CIPKs, multiple sequence alignment of the LsCIPK and AtCIPK protein sequences was performed using Clustal X 2.0 software. Based on the alignment results, a phylogenetic tree was constructed using the maximum likelihood (ML) method by MEGA 7.0 software. Model selection was based on the minimum Bayesian Information Criterion (BIC) value, and 1,000 bootstrap replicates were performed to assess branch reliability[43].

      Conserved motif analysis of LsCIPK protein sequences was performed using the MEME website (https://meme-suite.org/meme)[44], and their conserved domains were identified via the CDD-search platform. Subsequently, the Gene Structure View feature in TBtools was used, MEME results, genomic annotation information, and domain data were integrated and visualized in a single diagram[45].

    • The ExPASy ProtParam tool (https://web.expasy.org/protparam) was taken to perform a predictive analysis of the fundamental characteristics of the CIPK protein amino acid sequence, including physicochemical properties such as amino acid content, molecular weight, isoelectric point, hydrophobicity, and instability index[46]. Additionally, the subcellular localization was predicted using the online tool Cell-PLoc 2.0 (www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc).

    • The GFF3 file was downloaded from the Phytozome v13 database, and TBtools was used to extract the sequence spanning 2,000 bp upstream of the ATG start codon. Subsequently, the obtained sequences were uploaded to the PlantCare online platform (http://bioinformatics.psb.ugent.be/webtools/plantcare/html) to predict cis-acting elements in the promoter region, and the results would be visualized by TBtools[47].

    • To investigate evolutionary events within gene families, MCScanX software was employed for collinearity analysis to identify homologous blocks within the lettuce genome and between lettuce, Arabidopsis, and rice, thereby detecting tandem and segmental duplication events[48]. Subsequently, the Ka/Ks Calculator module in TBtools was used to compute the non-synonymous substitution rate (Ka), synonymous substitution rate (Ks), and the Ka/Ks ratio for collinear gene pairs. Ka, Ks data, and Ka/Ks visualization plots were generated and displayed by TBtools.

    • To compare the transcriptional responses of lettuce under salt stress vs drought stress conditions, differential expression gene (DEG) analysis was performed on the NaCl-treated group (CK vs NaCl) and the PEG-treated group (CK vs PEG), respectively. Based on the normalized expression matrix, DESeq2 was employed for differential expression analysis. The screening threshold was set to |log2FC| ≥ 1 and FDR < 0.05. The DEGs obtained under the two treatment conditions were imported into TBtools (v1.098) separately. The Venn Diagram module was used to perform intersection analysis, identifying co-differentially expressed genes (co-DEGs) involved in both salt and drought responses, as well as genes specific to each treatment. The final intersection statistics and Venn diagram visualization were automatically generated by TBtools.

    • To further elucidate the potential functions of specific differentially expressed genes (specific DEGs) under salt stress and drought stress, as well as their common differentially expressed genes, Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis were performed on the three categories of specific genes. First, the list of differentially expressed genes (DEGs) was imported into TBtools (v1.098). The GO enrichment module was used to perform statistical classification of genes into biological processes (BP), molecular functions (MF), and cellular components (CC). Subsequently, pathway enrichment analysis was conducted using the KEGG Enrichment module based on the official KEGG database, with a significance threshold set at Q < 0.05 (Benjamini–Hochberg correction). Both bar charts and scatter plots of enrichment results were automatically generated by TBtools for subsequent result visualization.

    • To analyze the expression patterns of the LsCIPKs under salt stress and drought stress conditions, gene expression levels under various treatment conditions were calculated and normalized based on transcriptome sequencing (RNA-seq) data. The screening criteria for differentially expressed genes were set as: |log2FC| ≥ 1 and FDR < 0.05 (DESeq2, Benjamini–Hochberg correction). The raw sequencing data was first aligned against the lettuce reference genome, using Hisat2 to obtain alignment results. Then, the FPKM expression levels for each gene were calculated using StringTie/FeatureCounts. Subsequently, the expression matrices of all samples were integrated. The expression data of LsCIPK genes were imported using TBtools (v1.098), and the Heatmap Illustrator module was employed to generate an expression heatmap illustrating the expression changes of LsCIPK genes under CK, NaCl, and PEG treatments.

    • Total RNA was isolated from finely ground lettuce leaf material using the Vanzyme RNA Extraction Kit (Nanjing Vanzyme Biotech Co., Ltd) after thorough grinding in liquid nitrogen. RNA concentration and purity were determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). Samples with an OD260/280 ratio between 1.8 and 2.1 were considered acceptable for quality. Simultaneously, RNA integrity was assessed via 1% agarose gel electrophoresis. Subsequently, 1 μg of total RNA was taken as a template, and first-strand cDNA synthesis was performed in a 20 μL reaction system with the Evo M-MLV reverse transcription kit (Changsha Aikrui Biotechnology Co., Ltd.). The resulting cDNA was stored at −20 °C for subsequent experiments.

      Real-time fluorescent quantitative PCR was performed in a 20 μL reaction system containing 10 μL of 2 × SYBR Green qPCR Mix (TSINGKE, Chengdu, China), with cDNA template quantity controlled below 100 ng. Additionally, 0.8 μL forward primer and 0.8 μL reverse primer (10 μmol/L; synthesized by BGI, Shenzhen, China) were added, with the remaining volume supplemented with RNase-free water. PCR amplification was performed on a CFX96 Touch real-time quantitative PCR instrument (Bio-Rad, USA). The reaction program was set as follows: 95 °C pre-denaturation for 5 min, followed by 40 cycles (95 °C for 10 s, 60 °C for 30 s); after amplification completion, a melting curve analysis was performed (95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s) to confirm the specificity of the amplified products.

      Based on drought and salt transcriptome data from lettuce, 12 CIPK genes were randomly selected, and quantitative primers for these genes were designed using Primer 5.0 software (Table 1), and their specificity was verified in the NCBI database. Lettuce Actin was used as a reference gene for expression normalization, with relative expression levels calculated using the 2−ΔΔCt method[49]. Each sample included three biological replicates, with three technical replicates per biological replicate to ensure experimental accuracy and reproducibility.

      Table 1.  qRT-PCR primers.

      Name Forward primers (5'-3') Reverse primers (5'-3')
      LsActin CTGGTGTGATGGTAGGTATGG CTCGTTGTAGAAAGTGTGATGC
      LsCIPK1 CGCGAAGGTCAAGTTTGCTC TGGGAGGTATCCAGCCATCA
      LsCIPK7 GTAGCACACCGTGACCTCAA CCGCCACCGTCTTCTCTATC
      LsCIPK13 TGAAGGTGACGGATTTCGGG CGACGTCGTCTTCGCAGATA
      LsCIPK21 CACGAGGTTTTGGCAAGCAA CCTCTGCCCGTTGTGATCTT
      LsCIPK25 GGCCTAAACCTGTCTGCCTT ACGGAAGCTCCTTCAAGACG
      LsCIPK26 TTGGACTCAGCGCTTTTTGC CACCAGAAACGACGGAGTGA
      LsCIPK29 AGGTCTACCATGGCTGGGAT ACGTCCATTTCGGAACACGA
      LsCIPK31 CCAGCAATTGATCACAGCCG GGTGCCACATAAGCAGGAGT
      LsCIPK32 CACATGTGGTACTCCGGCTT CACCATGCCATGCACAAACA

      Experimental results are presented as 'mean ± standard deviation (SD)'. Statistical analysis was performed using SPSS software (IBM SPSS Statistics 26.0). Data was first subjected to one-way analysis of variance (ANOVA), followed by Duncan's multiple comparison test to examine differences between treatments. A p-value < 0.05 was considered statistically significant.

    • The complete coding sequence (CDS) of the LsCIPK32 lacking a stop codon was cloned into the 35S::GFP vector to generate the recombinant construct 35S::LsCIPK32-GFP. 35S::GFP and 35S::LsCIPK32-GFP plasmids were then transformed into Agrobacterium GV3101, suspended in 100 mL of infiltration buffer (0.042 g MES; 0.048 g MgCl2·6H2O; 100 mM acetophenone; pH 5.5), adjusted to an OD600 of 0.4–0.6, and injected into four-week-old Nicotiana benthamiana leaves. After 24 h of dark incubation and 48 h post-infiltration, imaging was performed using a Nikon C2-ER confocal microscope (Nikon, Tokyo, Japan) equipped with a 488 nm argon ion laser (15% intensity), a 515/30 nm emission filter, and a CFI Plan Apo λ 40 × oil immersion objective (NA = 1.3) to scan the Z-axis at 1 μm intervals.

    • We identified 32 CIPK genes in lettuce (designated LsCIPK1LsCIPK32) through combined BLASTP and HMMER screening using Arabidopsis and rice CIPK protein sequences. Chromosomal localization analysis revealed that these genes were distributed across nine chromosomes, and exhibited a markedly unbalanced distribution (Fig. 1). Among them, LsChr1, LsChr5, and LsChr7 had relatively high numbers of genes (five, eight, and five members, respectively), while other chromosomes contained only one to four genes. Most genes exhibited scattered distribution, though localized gene clusters were also observed. For instance, LsCIPK14LsCIPK17 formed a tightly clustered arrangement on LsChr5, potentially associated with gene duplication events.

      Figure 1. 

      Chromosomal distribution of the lettuce CIPK gene family. Blue bars represent lettuce chromosomes (LsChr1–LsChr9), with physical distances (Mb) shown on the left. Red text indicates CIPK gene names.

    • To understand the fundamental characteristics of the LsCIPK protein, its amino acid length, molecular weight, isoelectric point, instability index, aliphatic index, hydrophilicity, and subcellular localization were analyzed (Table 2). The results indicated that LsCIPK proteins exhibited considerable variation, and the molecular weight of most members was concentrated within the 50−55 kDa. The theoretical isoelectric points predominantly fell within the alkaline range (pI > 8), consistent with the typical physicochemical characteristics of CIPK. The instability index results indicated that most members exhibited a tendency toward instability; however, their generally high aliphatic indices suggested overall good thermal stability. All LsCIPK GRAVY values were negative, indicating pronounced hydrophilic characteristics. Subcellular localization predictions suggested that LsCIPKs were primarily distributed in the cytoplasm and plasma membrane, while some members localize to chloroplasts, nuclei, or the endoplasmic reticulum, reflecting their potential involvement in signal transduction processes across multiple organelles.

      Table 2.  Physicochemical properties of the lettuce CIPK gene family.

      Gene name The number
      of amino acid
      Molecular
      weight (Da)
      Theoretical pI Instability index Aliphatic
      index
      Grand average of hydropathicity Subcellular localization prediction
      LsCIPK1 904 102,285.14 6.54 40.05 88.36 −0.306 Plasma membrane; Cytoplasm; Endoplasmic Reticulum
      LsCIPK2 458 52,131.89 8.82 41.22 78.08 −0.398 Cytoplasm; Chloroplast; Nucleus
      LsCIPK3 446 5,0691.35 8 31.65 90.45 −0.4 Cytoplasm; Peroxisome; Nucleus
      LsCIPK4 483 54,689.08 8.88 42.81 88.36 −0.295 Chloroplast; Mitochondrion; Extracellular space
      LsCIPK5 482 54,396.49 8.96 29.92 77.86 −0.461 Chloroplast; Endoplasmic Reticulum; Plasma membrane
      LsCIPK6 2,890 328,456.35 7.36 38.07 83.37 −0.412 Plasma membrane; Nucleus; Endoplasmic Reticulum
      LsCIPK7 437 48,880.63 9.07 35.68 91.24 −0.308 Chloroplast; Golgi apparatus; Plasma membrane
      LsCIPK8 440 50,107.46 8.92 42.65 79.07 −0.526 Mitochondrion; Plasma membrane; Nucleus
      LsCIPK9 499 56,623.4 8.93 43.68 88.28 −0.323 Chloroplast; Vacuole; Cytoplasm
      LsCIPK10 462 52,465.55 9.03 28.57 81.43 −0.443 Cytoplasm; Endoplasmic Reticulum; Chloroplast
      LsCIPK11 441 50,187.94 9.02 35.63 84.22 −0.323 Cytoplasm; Nucleus; Endoplasmic Reticulum
      LsCIPK12 460 51,846.01 9.2 44.36 91.78 −0.272 Chloroplast; Plasma membrane; Cytoplasm
      LsCIPK13 427 47,976.37 8.86 36.01 82.41 −0.371 Plasma membrane; Endoplasmic Reticulum; Cytoplasm
      LsCIPK14 806 91,426.57 7.9 22.16 99.85 −0.109 Plasma membrane; Cytoplasm; Endoplasmic Reticulum
      LsCIPK15 878 99,016.35 8.26 32.55 89.25 −0.324 Plasma membrane; Endoplasmic Reticulum; Cytoplasm
      LsCIPK16 439 49,560.31 7.24 34.87 91.46 −0.294 Cytoplasm; Chloroplast; Endoplasmic Reticulum
      LsCIPK17 437 49,440.97 8.66 34.67 97.21 −0.25 Cytoplasm; Cytoskeleton; Chloroplast
      LsCIPK18 871 99,290.81 9.24 43.07 92.55 −0.367 Cytoplasm; Nucleus; Chloroplast
      LsCIPK19 432 48,527.79 8.85 40.83 90.67 −0.278 Chloroplast; Nucleus; Cytoplasm
      LsCIPK20 445 49,952.97 7.07 31.66 78.63 −0.356 Chloroplast; Plasma membrane; Nucleus
      LsCIPK21 451 50,541.88 6.3 35.49 93.08 −0.345 Cytoplasm; Nucleus; Chloroplast
      LsCIPK22 455 51,728.97 6.55 26.87 92.13 −0.283 Cytoplasm; Chloroplast; Plasma membrane
      LsCIPK23 459 52,112.4 9.07 48.33 85.14 −0.283 Chloroplast; Cytoplasm; Mitochondrion
      LsCIPK24 454 51,137.91 9.02 36.47 85.46 −0.369 Chloroplast; Mitochondrion; Golgi apparatus
      LsCIPK25 1,335 151,026.24 8.61 29.65 91.98 −0.245 Plasma membrane; Endoplasmic Reticulum; Vacuole
      LsCIPK26 428 48,055.44 9.06 32.74 82.69 −0.34 Plasma membrane; Cytoplasm; Endoplasmic Reticulum
      LsCIPK27 829 94,260.65 8.64 34.86 91.71 −0.243 Plasma membrane; Endoplasmic Reticulum
      LsCIPK28 428 47,731.15 9.23 32.27 84.28 −0.31 Plasma membrane; Endoplasmic Reticulum; Cytoplasm
      LsCIPK29 466 52,966.58 6.48 42.05 87.88 −0.283 Chloroplast; Extracellular space; Cytoplasm
      LsCIPK30 429 49,029.58 9.03 43.56 92.45 −0.316 Cytoskeleton; Cytoplasm; Cytoplasm & Nucleus
      LsCIPK31 458 52,243.51 8.99 42.3 88.54 −0.441 Cytoplasm; Cytoskeleton; Chloroplast
      LsCIPK32 456 5,1765.2 8.63 35.59 86.1 −0.269 Cytoplasm; Cytoskeleton; Golgi apparatus
    • To reveal the structural characteristics of the LsCIPKs, its protein conserved domains and gene structures were analyzed. The results showed that all LsCIPK proteins contained the characteristic PKc-like kinase domain and the NAF (PF03822) regulatory domain, indicating they are typical members of the CIPK family (Fig. 2a). Most of proteins also harbored conserved segments such as CIPK_C or STKc_SnRK3, with highly consistent overall domain compositions, suggesting strong structural conservation within this family during evolution. In terms of gene structure, the number of exons varied considerably among different LsCIPK genes, ranging from 1 to 16, but nearly half of the members exhibit a single-exon structure (Fig. 2b). Some genes possessed a higher number of exons (12–16), indicating structural diversity within the family.

      Figure 2. 

      Conserved domains and gene structure analysis of the CIPK gene family in lettuce. (a) Conserved domain distribution of the LsCIPK protein. Different colors represent different domain types; the corresponding domain names are labeled on the right. (b) Exon-intron structure of the LsCIPK gene. Yellow boxes represent coding regions (CDS), green boxes represent untranslated regions (UTR), and black lines represent introns.

    • To analyze the phylogenetic relationships of the lettuce CIPKs, multiple sequence alignments were performed using CIPK protein sequences from lettuce and Arabidopsis, and the phylogenetic tree was constructed based on the Neighbor-Joining (NJ) method (Fig. 3). The results indicated that the CIPK family is divided into five major branches (Group I–V), with a structural classification pattern highly consistent with that of Arabidopsis. Among the five branches, Group III, Group IV, and Group V contain a higher number of lettuce genes. Most of the lettuce members cluster closely with Arabidopsis homologs, indicating high evolutionary conservation within this family. Additionally, some genes cluster in pairs (e.g., LsCIPK15/16, LsCIPK3/21), which might result from gene duplication events.

      Figure 3. 

      Phylogenetic tree of the CIPK gene family in lettuce and Arabidopsis. Different colors represent five evolutionary branches (Group I–V). CIPK proteins in lettuce and Arabidopsis are distinguished as 'LsCIPK' and 'AtCIPK'.

    • To elucidate the potential regulatory mechanisms of the LsCIPK gene, cis-acting elements within the 2,000 bp region upstream of its promoter were analyzed. A total of 49 classes and 813 cis-elements were identified, which can be categorized into four major functional groups: light response, hormone response, stress response, and growth-and-development-related responses (Fig. 4). The light-responsive elements were the most abundant, with Box4 and G-Box appearing 90 and 76 times, respectively. Among hormone response elements, the ABA response element ABRE is the most abundant (67 occurrences). Most genes simultaneously contained both MeJA-related CGTCA-motifs and TGACG-motifs, suggesting that LsCIPKs might be broadly involved in hormone-mediated signal regulation. Among stress response elements, ARE (67), MBS (24), and LTR (19) showed widespread distribution, indicating that the LsCIPK gene might play a role in responses to abiotic stresses such as anaerobiosis, drought, and low temperature. The marked variation in the number of stress elements among different members suggested functional differentiation in stress regulation. Additionally, multiple cis-elements associated with growth and development were detected, such as MSA-like, CAT-box, and circadian elements, indicating that the expression of LsCIPKs might also be regulated by developmental stages and circadian rhythms. Overall, the LsCIPK promoter region was rich in light-, hormone-, and stress-response elements, suggesting that this gene family might play a crucial role in environmental signal perception and response.

      Figure 4. 

      Analysis of cis-acting elements associated with specific plant hormones and abiotic stresses within 2,000 bp upstream of the LsCIPKs sequence.

    • To analyze the expansion pattern and evolutionary characteristics of the CIPK gene family in lettuce, MCScanX was employed to examine their collinearity relationships within the genome (Fig. 5). The results revealed that 32 LsCIPK genes are distributed across nine chromosomes, forming eight pairs of collinear duplicate genes, including LsCIPK2/LsCIPK11, LsCIPK9/LsCIPK22, LsCIPK13/LsCIPK26, LsCIPK13/LsCIPK28, LsCIPK25/LsCIPK27, LsCIPK26/LsCIPK28, LsCIPK31/LsCIPK32, and LsCIPK30/XM_023875268.3. Although the LsCIPK genes exhibit a relatively dispersed distribution across chromosomes, they maintain clear collinearity, indicating that this gene family underwent expansion driven by segmental duplication in lettuce, and possesses high structural conservation.

      Figure 5. 

      Genome-wide colinearity analysis of the lettuce CIPK gene family. Arcs of different colors represent homologous gene pairs between chromosomes; the green outer ring depicts the nine chromosomes of lettuce (LsChr1–LsChr9). The heatmap colors (blue, red) indicate a gradient of sequence similarity (from low to high).

      To further evaluate the selective pressure following gene duplication, Ka/Ks analysis was performed on the duplicated genes mentioned above (Fig. 6). The Ka/Ks ratios for all gene pairs were less than 1 (0.0588–0.1278), indicating that the LsCIPK gene family as a whole underwent strong purifying selection, with its function remaining stable throughout evolution. Among these, LsCIPK2/LsCIPK11 and LsCIPK25/LsCIPK27 exhibit slightly higher Ka/Ks ratios, suggesting a potential trend toward weak functional differentiation. Conversely, LsCIPK13/LsCIPK26 and LsCIPK26/LsCIPK28 display the lowest Ka/Ks ratios, indicating they were subject to more stringent conservation selection. Combining the results of collinearity analysis and Ka/Ks ratios, we revealed that the expansion of the lettuce CIPK gene family was primarily driven by segmental duplication events. This family has maintained highly conserved molecular characteristics throughout long-term evolution, consistent with the evolutionary patterns observed in CIPK families of plants such as Arabidopsis and rice.

      Figure 6. 

      Analysis of Ka/Ks ratios for collinear genes in the lettuce CIPK gene family. The bubble chart displays the distribution of Ka, Ks, and Ka/Ks values for each gene pair, with color and bubble size indicating the range of Ka/Ks ratios.

      To assess the evolutionary conservation of the lettuce CIPK gene family across different plant species, a collinearity relationship map was constructed using MCScanX, between lettuce, Arabidopsis, and rice (Fig. 7). The results revealed abundant collinearity connections between lettuce and Arabidopsis thaliana, primarily involving regions such as AtChr1, AtChr2, AtChr3, AtChr4, AtChr5, and lettuce LsChr1, LsChr4, LsChr5, LsChr6, LsChr7, LsChr8, and LsChr9. This indicated high homology and conservation in the CIPK gene family between the two species. Some LsCIPK genes also form one-to-many or many-to-one correspondences with multiple Arabidopsis CIPK members, reflecting the duplication and retention phenomena within the CIPK family in dicotyledonous plants. In contrast, the number of colinear connections between lettuce and rice was significantly lower, with limited homologous regions detected only on OsChr1, OsChr5, OsChr6, OsChr7, OsChr9, OsChr11, and OsChr12, indicating that following the divergence of monocots and dicots, the CIPK family underwent substantial structural and sequential diversification, resulting in reduced conservation. In summary, the lettuce CIPK gene family exhibits significantly higher conservation within dicotyledons than in homologous relationships with monocotyledons. This suggested that the family had maintained a more consistent evolutionary pattern within the dicotyledonous lineage, whereas monocotyledons had undergone more pronounced rearrangement and diversification.

      Figure 7. 

      Cross-species orthology analysis of the CIPK gene families in lettuce, Arabidopsis, and rice. Red lines indicate homologous gene pairs between different species; the top panel shows Arabidopsis chromosomes (red), the middle panel shows lettuce chromosomes (green), and the bottom panel shows rice chromosomes (blue); the density of lines reflects the degree of colinearity among CIPK genes across different species.

    • To compare the transcriptional response patterns of lettuce to different abiotic stresses, an intersection analysis was performed on differentially expressed genes (DEGs) from salt stress (CK vs NaCl) and drought stress (CK vs PEG) treatments (Fig. 8). Results revealed that 4,806 differentially expressed genes (DEGs) were identified under salt stress, including 1,619 salt-specific genes; 4,438 DEGs were identified under drought stress, including 1,251 drought-specific genes, and 3,187 genes exhibited consistent expression changes across both stresses.

      Figure 8. 

      Venn diagram of differentially expressed genes in lettuce under salt stress and drought stress. Blue and orange circles represent DEGs under salt stress and drought stress, respectively. The overlapping region indicates differentially expressed genes common to both treatments.

    • To analyze the functional characteristics of genes specifically responding to salt stress, GO and KEGG enrichment analyses were performed on 1,619 genes differentially expressed in response to NaCl treatment (Fig. 9). GO analysis revealed that these genes were primarily enriched in entries related to transferase activity, kinase activity, transcriptional regulation activity, protein modification processes, plasma membrane, and chloroplast-associated functions (Fig. 9a). This indicated that salt stress significantly impacted signal transduction, membrane structural homeostasis, and photosynthetic organ function. KEGG analysis further revealed that the specific DEGs were significantly enriched in multiple metabolism-related pathways, including metabolic pathways, mitochondrial biogenesis, transport proteins, DNA replication proteins, and amino acid metabolism (Fig. 9b). Additionally, the enrichment of pathways such as ubiquitin-mediated protein degradation and P450 redox reactions indicated that salt stress might also participate in the response by regulating protein turnover and redox balance. In summary, genes specifically responsive to salt stress primarily participate in processes such as signal perception, transmembrane transport, energy and nitrogen-carbon metabolism, protein processing, and redox regulation.

      Figure 9. 

      GO and KEGG functional enrichment analysis of NaCl-treated differentially expressed genes. (a) GO enrichment analysis; (b) KEGG enrichment analysis. Bubble size indicates the number of enriched genes, color represents significance (Q-value), and the horizontal axis shows enrichment factor. A smaller Q-value indicates more significant enrichment.

      To elucidate the specific response mechanisms to drought stress, GO and KEGG enrichment analyses were performed on 1,251 PEG-treated differentially expressed genes (Fig. 10). GO analysis revealed that these genes were primarily enriched in entries such as cellular processes, intracellular structures, nucleotide metabolism, hydrolase activity, RNA binding, and mitochondrial-related functions (Fig. 10a). These enriched items indicated that drought stress significantly impacted fundamental cellular metabolic activities and enhanced processes related to energy production, RNA processing, and transcriptional regulation. KEGG analysis revealed that drought-specific DEGs were primarily enriched in pathways, including genetic information processing, chromosome-associated proteins, ribosome biosynthesis, mRNA and tRNA synthesis, and plant–pathogen interactions (Fig. 10b). The activation of these pathways indicated that lettuce might maintain physiological function by regulating transcriptional and translational processes, cellular defense responses, and nucleic acid metabolism under drought stress. In summary, PEG-induced stress-responsive genes are primarily involved in genetic information processing, cellular metabolic regulation, and stress signal response.

      Figure 10. 

      GO and KEGG functional enrichment analysis of PEG-treated differentially expressed genes. (a) GO enrichment analysis; (b) KEGG enrichment analysis. Bubble size indicates the number of enriched genes, color represents significance (Q-value), and the horizontal axis shows enrichment factor. A smaller Q-value indicates more significant enrichment.

      To investigate the common response mechanisms to salt and drought stress, GO and KEGG enrichment analyses were performed on 3,187 co-differentially expressed genes (Fig. 11). GO enrichment analysis revealed that these common DEGs were primarily distributed across entries such as intracellular structures, cytoplasm, nucleotide metabolism, chemical stimulus response, stress response, and abiotic stress response (Fig. 11a). Additionally, it was significantly enriched in functional categories such as chloroplasts, mitochondria, DNA-binding transcription factor activity, and nuclease activity, indicating that both salt and drought stress affected core cellular processes including basal metabolism, energy conversion, and transcriptional regulation. KEGG analysis revealed that these genes were primarily enriched in pathways, including metabolism, signaling and cellular process-related protein families, substance transport, mitochondrial biogenesis, chaperone protein folding, amino acid metabolism, and ribosome biogenesis (Fig. 11b). Concurrently, significant enrichment was observed in pathways related to protein degradation, glutathione metabolism, and photosynthesis, suggesting that these shared DEGs were broadly involved in stress signal regulation, antioxidant defense, and energy balance maintenance. Overall, differentially expressed genes induced by combined salt and drought stress are primarily involved in fundamental processes such as cellular metabolic regulation, redox balance, and energy conversion, reflecting their shared molecular response patterns in lettuce's adaptation to various abiotic stresses.

      Figure 11. 

      GO and KEGG functional enrichment analysis of genes differentially expressed in both salt stress and drought stress. (a) GO enrichment analysis; (b) KEGG enrichment analysis. Bubble size indicates the number of enriched genes, color represents significance (Q-value), and the horizontal axis shows enrichment factor. A smaller Q-value indicates more significant enrichment.

    • To evaluate the expression patterns of the lettuce CIPK genes under abiotic stress, transcriptomic data was analyzed to examine the expression levels of 32 LsCIPKs under salt stress (NaCl) and drought stress (PEG) treatments (Fig. 12). The results indicated that the LsCIPK gene family exhibited extensive expression changes under both stress conditions. The expression level of multiple members (such as LsCIPK2, LsCIPK7, LsCIPK8, LsCIPK26, LsCIPK27, and LsCIPK32) were upregulated under both NaCl and PEG treatments. Among them, the expression of LsCIPK26 and LsCIPK28 was upregulated significantly. Another group of members (such as LsCIPK5, LsCIPK6, LsCIPK13, LsCIPK23, LsCIPK25, and LsCIPK29) showed consistent downregulation under both treatment conditions. Additionally, certain genes exhibited differential responses under different stress conditions. For instance, the expression patterns of LsCIPK5, LsCIPK9, and LsCIPK16 were inconsistent under salt and drought stresses.

      Figure 12. 

      Heatmap of expression patterns of the LsCIPK genes under salt stress (NaCl) and drought stress (PEG) treatments. The color bars in the heatmap represent expression levels converted to log2 (log2[TPM + 1]), with values ranging from 0 to 10: dark blue indicates lower expression, while dark red indicates higher expression. CK denotes the control group, NaCl represents the salt stress treatment group, and PEG indicates the drought stress treatment group.

    • To validate the expression patterns detected by transcriptomics, nine LsCIPK genes (LsCIPK7, LsCIPK12, LsCIPK13, LsCIPK19, LsCIPK21, LsCIPK25, LsCIPK26, LsCIPK29, and LsCIPK32) were selected for qRT-PCR analysis to examine their expression under salt stress (NaCl) and drought stress (PEG) treatments (Fig. 13). The results indicated that gene expression responses to the two types of abiotic stress varied significantly. Among them, LsCIPK7, LsCIPK26, and LsCIPK32 showed significant upregulation under both NaCl and PEG treatments, consistent with the transcriptome results. The expression levels of LsCIPK12, LsCIPK19, and LsCIPK21 showed minimal variation under both stress conditions, remaining relatively stable overall. LsCIPK13, LsCIPK25, and LsCIPK29 were all downregulated under both NaCl and PEG treatment conditions. qRT-PCR results showed high consistency with transcriptomic data.

      Figure 13. 

      qRT-PCR expression analysis of the lettuce CIPK genes under salt (NaCl), and drought (PEG) stress. CK represents the control group, NaCl denotes the salt stress treatment group, and PEG indicates the drought stress treatment group; error bars represent standard errors (n = 5); ns indicates p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

    • To determine the intracellular localization of LsCIPK proteins, a 35S:LsCIPK32-GFP fusion expression vector was constructed using LsCIPK32 as a representative protein. This vector was transiently transformed into tobacco epidermal cells for fluorescence observation, with 35S:GFP serving as the empty vector control (Fig. 14). Confocal microscopy observations revealed that the empty vector GFP exhibited a freely diffusing distribution within cells, with fluorescent signals detectable in both the cytoplasm and the nucleus. The fluorescence signal of LsCIPK32-GFP was predominantly localized to the nucleus, with distinct membrane-bound distribution observed in the plasma membrane region. No widespread cytoplasmic diffusion was detected. These results indicated that the LsCIPK32 protein exhibited dual localization to both the nucleus and plasma membrane, consistent with its potential signaling function.

      Figure 14. 

      Subcellular localization analysis of the LsCIPK32 protein. Merge, RFP, GFP, and Bright Field represent signal merging, red fluorescence channel, green fluorescence channel, and bright field image, respectively. Scale bar = 50 μm.

    • The CBL–CIPK signaling system, as a core regulatory module mediating Ca2+-dependent stress responses in plants, plays a pivotal role under salt stress, drought stress, and various environmental stimuli[50]. Research indicated that CIPK proteins regulated various adaptive mechanisms, including ion homeostasis, osmotic regulation, and redox balance, by forming complexes with CBL proteins, thereby enhancing plant tolerance to adverse environmental conditions[2]. In this study, 32 CIPK genes were systematically identified in the lettuce genome, a number comparable to those in Arabidopsis[24], rice[25], tomato[29], potato[30], and pepper[31], indicating high conservation of the CIPK family across dicotyledonous plants. Chromosomal mapping results indicated that LsCIPK genes exhibited an uneven distribution across nine chromosomes, with some members clustered together, suggesting potential tandem duplication or segmental duplication events. This expansion pattern aligns with the formation mechanism of CIPK gene families in crops such as Chinese cabbage[26], cotton[27], and grape[28], suggesting that segmental duplication is a common evolutionary mechanism in dicotyledonous plants.

      Phylogenetic analysis revealed that the lettuce CIPK family can be divided into five major branches, with clear correspondence between its members and the CIPKs members of Arabidopsis, indicating that the gene family had maintained high sequence conservation during evolution, consistent with previous findings in grape[28], tomato[29], and pecan[33]. Further conservative domain analysis indicated that all LsCIPK proteins contained the characteristic PKc-like and NAF domains, which constituted the structural basis for CIPK protein interaction with CBL[4,5,24]. Additionally, gene structures exhibited distinct 'high/low intron' patterns, a phenomenon also observed in species such as rice[25], potato[30], and quinoa[20], which suggested that CIPK genes with different structural categories might perform distinct regulatory functions in lettuce as well.

      Analysis of cis-acting elements revealed that most of the LsCIPK gene promoter regions contained abundant light-responsive, hormone-responsive, and stress-responsive elements, particularly those associated with ABA, MeJA, and drought/cold stress responses. This feature was highly consistent with the regulatory functions of the CIPK family in the ABA signaling pathway, osmotic stress, and light signaling[1722]. In Arabidopsis, CIPK1 participates in regulating drought responses by phosphorylating the ABA receptor PYL4[19]; in chili peppers, CIPK genes have also been demonstrated to participate in ABA-dependent stress signaling pathways[22]. Therefore, it is hypothesized that the lettuce CIPK gene might participate in stress regulation within a multi-hormone network, but its specific role required further functional validation.

      Genome-wide synteny analysis revealed that the expansion of the lettuce CIPK gene family was primarily driven by segmental duplication. Furthermore, the Ka/Ks ratios for all eight duplicated gene pairs was less than 1, indicating that this family was under intense purifying selection, which was highly consistent with research on some crops, such as Chinese cabbage[26], cotton[27], and turnips[32], indicating that CIPK genes, as core members of signaling pathways, have remained highly conserved throughout plant evolution.

      Based on transcriptome expression analysis, most LsCIPK genes showed significant upregulation or downregulation under salt and drought stress, indicating that these genes might be extensively involved in the regulation of stress signaling. Among these, LsCIPK7, LsCIPK26, and LsCIPK32 were significantly upregulated under both types of stress, consistent with previously reported positively regulated CIPK members in species, such as quinoa[20], potato[30], and cassava[17]. However, LsCIPK13, LsCIPK25, and LsCIPK29 exhibited sustained downregulation under both stress conditions, suggesting these genes might function as negative regulators in lettuce stress response pathways, which was analogous to the negative regulatory function of AtCIPK1 in Arabidopsis under drought stress[19]. qRT-PCR results showed high consistency with transcriptomic data, further validating the reliability of the expression patterns.

      Additionally, the expression of LsCIPK32 was upregulated under both NaCl and PEG treatments based on qRT-PCR and transcriptomic data. To further clarify its function, subcellular localization of LsCIPK32 was detected, and the results indicated that LsCIPK32 is primarily distributed in the nucleus and cytoplasm, consistent with the functional mode of most CIPKs that regulate SOS1 or other ion transporters through membrane localization[811]. In various plant species, CIPK membrane localization typically indicate involvement in ion efflux, osmotic regulation, or membrane signaling[711,31]. Therefore, LsCIPK32 might play a crucial role in salt stress and drought responses in lettuce.

      In summary, the composition, structural characteristics, evolutionary relationships, and expression patterns of lettuce CIPKs under salt and drought stress was systematically analyzed. Subsequently, CRISPR/Cas9 and overexpression materials would be taken to validate the functions of LsCIPK genes, such as LsCIPK7, LsCIPK26, and LsCIPK32, which would further elucidate the regulatory network of the CBL-CIPK complex in lettuce stress responses, providing theoretical foundations and candidate gene resources for molecular breeding of stress-tolerant lettuce.

    • In this study, 32 LsCIPK genes were identified in the lettuce genome, and their chromosomal distribution, structural characteristics, phylogenetic relationships, and duplication patterns were systematically analyzed. Collinearity and Ka/Ks analysis indicated that the expansion of this family was primarily driven by segmental duplication, and had maintained high conservation over long term evolution. Cis-element analysis revealed that LsCIPKs were broadly involved in light signaling, hormone regulation, and stress responses. Transcriptome and qRT-PCR results indicated that multiple genes (such as LsCIPK7, LsCIPK26, and LsCIPK32) were significantly induced under salt and drought stress, suggesting their potential key roles in stress responses. Subcellular localization revealed that LsCIPK32s were distributed in both the nucleus and cytoplasm. This study lays the foundation for functional research on the CIPK genes in lettuce and provides important genetic resources for subsequent analysis of stress signaling networks, and the development of stress-tolerant lettuce breeding programs.

      • The authors confirm contribution to the paper as follows: study conception and design, analysis and interpretation of results: Li J, Li K, Li Z; data collection: Li J, Chu W, Zhao Q; draft manuscript preparation: Wu R, Yin L. All authors reviewed the results and approved the final version of the manuscript.

      • The sequence data for the expression pattern analysis of LsCIPK genes in response to salt or drought conditions is available at NCBI: PRJNA1367680.

      • This study was supported by the Handan Science and Technology Research and Development Plan Project (21422012321).

      • The authors declare that they have no conflict of interest.

      • # Authors contributed equally: Jiawei Li, Zixuan Li, Ke Li

      • Copyright: © 2026 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (14)  Table (2) References (50)
  • About this article
    Cite this article
    Li J, Li Z, Li K, Chu W, Zhao Q, et al. 2026. Genome-wide identification of the CIPK gene family in lettuce and expression analysis under salt and drought stress. Vegetable Research 6: e012 doi: 10.48130/vegres-0026-0005
    Li J, Li Z, Li K, Chu W, Zhao Q, et al. 2026. Genome-wide identification of the CIPK gene family in lettuce and expression analysis under salt and drought stress. Vegetable Research 6: e012 doi: 10.48130/vegres-0026-0005

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return