Search
2025 Volume 1
Article Contents
ORIGINAL RESEARCH   Open Access    

Sludge-derived hydrothermal carbonization aqueous phase regulates agro-ecosystem multifunctionality by affecting cross-trophic community in periphyton

  • # Authors contributed equally: Xudong Zhong, Bingyu Wang
    Full list of author information is available at the end of the article.

  • HAP reduces the ecosystem multifunctionality of periphyton by simplifying interdomain network architecture.

    Cross-trophic community interactions are the primary driver of periphyton multifunctionality under HAP stress.

    Periphyton exhibits functional compensation to HAP by reorganizing trophic guilds and shifting metabolic pathways.

  • Hydrothermal carbonization (HTC) is an efficient sludge conversion technology that generates a nutrient- and dissolved organic matter-rich aqueous phase (HAP) with potential for agricultural reuse. Given its intended application, evaluating the ecological effects of HAP on soil-water interface bio-processes in agroecosystems is critically important. This study employed periphyton as a model system to assess its functional responses to sludge-derived HAP at different concentrations, innovatively investigating the role of cross-trophic interactions as a central mediator. Physicochemical parameters were systematically monitored throughout the cultivation, as well as the bacterial and eukaryotic communities. The results demonstrate that periphyton maintained notable nutrient removal capacity even under high HAP stress, with removal rates remaining up to 55% for COD, and 35% for NH4+-N at the highest HAP input level. However, this capacity decreased with increasing HAP concentration. While microbial α-diversity remained stable, HAP significantly reshaped the species composition and community structure of both bacteria and eukaryota (p < 0.05), primarily driven by shifts in trophic guilds and environmental factors. It was found that HAP reduced the periphyton's ecological multifunctionality by narrowing its niche breadth and simplifying the interdomain network architecture, highlighting a previously underappreciated mechanism. Notably, the findings also reveal that HAP induced adaptive regulatory and functional compensation strategies in periphyton, maintaining nutrients removal through reorganization of trophic guilds and functional groups. This study provides novel insights into the ecological risk assessment of HAP and supports the development of sustainable management strategies for its agricultural application.
    Graphical Abstract
  • 加载中
  • The supplementary files can be downloaded from here.
  • [1] Wang J, Yu F, Wang X, Wang Y, Cheng Z, et al. 2024. Efficient reclamation of phosphorus from wetland plant via CaCl2/NaOH-mediated hydrothermal carbonization: insights from the evolution of phosphorus. Carbon Research 3:36 doi: 10.1007/s44246-024-00120-5

    CrossRef   Google Scholar

    [2] Khosravi A, Yuan Y, Liu Q, Zheng H, Hashemi M, et al. 2024. Hydrochars as slow-release phosphorus fertilizers for enhancing corn and soybean growth in an agricultural soil. Carbon Research 3:7 doi: 10.1007/s44246-023-00086-w

    CrossRef   Google Scholar

    [3] Bevan E, Fu J, Luberti M, Zheng Y. 2021. Challenges and opportunities of hydrothermal carbonisation in the UK; case study in Chirnside. RSC Advances 11:34870−34897 doi: 10.1039/D1RA06736B

    CrossRef   Google Scholar

    [4] Fernández-Sanromán Á, Lama G, Pazos M, Rosales E, Sanromán MÁ. 2021. Bridging the gap to hydrochar production and its application into frameworks of bioenergy, environmental and biocatalysis areas. Bioresource Technology 320:124399 doi: 10.1016/j.biortech.2020.124399

    CrossRef   Google Scholar

    [5] Zhao Q, Guo W, Zhu Y, Li D, Liu X, et al. 2025. Soil–plant-microbial evidence for the available phosphorus generation and utilization of Ca/Mg salts conditioned hydrochar from sewage sludge. Carbon Research 4:64 doi: 10.1007/s44246-025-00228-2

    CrossRef   Google Scholar

    [6] Usman M, Chen H, Chen K, Ren S, Clark JH, et al. 2019. Characterization and utilization of aqueous products from hydrothermal conversion of biomass for bio-oil and hydro-char production: a review. Green Chemistry 21:1553−1572 doi: 10.1039/C8GC03957G

    CrossRef   Google Scholar

    [7] Feng Y, He H, Li D, He S, Yang B, et al. 2021. Biowaste hydrothermal carbonization aqueous product application in rice paddy: focus on rice growth and ammonia volatilization. Chemosphere 277:130233 doi: 10.1016/j.chemosphere.2021.130233

    CrossRef   Google Scholar

    [8] He H, Feng Y, Wang H, Wang B, Xie W, et al. 2022. Waste-based hydrothermal carbonization aqueous phase substitutes urea for rice paddy return: Improved soil fertility and grain yield. Journal of Cleaner Production 344:131135 doi: 10.1016/j.jclepro.2022.131135

    CrossRef   Google Scholar

    [9] Mau V, Neumann J, Wehrli B, Gross A. 2019. Nutrient behavior in hydrothermal carbonization aqueous phase following recirculation and reuse. Environmental Science & Technology 53:10426−10434 doi: 10.1021/acs.est.9b03080

    CrossRef   Google Scholar

    [10] Yao C, Pan Y, Lu H, Wu P, Meng Y, et al. 2016. Utilization of recovered nitrogen from hydrothermal carbonization process by Arthrospira platensis. Bioresource Technology 212:26−34 doi: 10.1016/j.biortech.2016.03.166

    CrossRef   Google Scholar

    [11] Tarhan SZ, Koçer AT, Özçimen D, Gökalp İ. 2021. Cultivation of green microalgae by recovering aqueous nutrients in hydrothermal carbonization process water of biomass wastes. Journal of Water Process Engineering 40:101783 doi: 10.1016/j.jwpe.2020.101783

    CrossRef   Google Scholar

    [12] Jena U, Vaidyanathan N, Chinnasamy S, Das KC. 2011. Evaluation of microalgae cultivation using recovered aqueous co-product from thermochemical liquefaction of algal biomass. Bioresource Technology 102:3380−3387 doi: 10.1016/j.biortech.2010.09.111

    CrossRef   Google Scholar

    [13] Li D, Chu Q, Wang J, Qian C, Chen C, et al. 2023. Effect of hydrothermal carbonization aqueous phase on soil dissolved organic matter and microbial community during rice production: a two-year experiment. Agriculture, Ecosystems & Environment 356:108637 doi: 10.1016/j.agee.2023.108637

    CrossRef   Google Scholar

    [14] Bonet B, Corcoll N, Acuňa V, Sigg L, Behra R, et al. 2013. Seasonal changes in antioxidant enzyme activities of freshwater biofilms in a metal polluted Mediterranean stream. Science of The Total Environment 444:60−72 doi: 10.1016/j.scitotenv.2012.11.036

    CrossRef   Google Scholar

    [15] Hagerthey SE, Bellinger BJ, Wheeler K, Gantar M, Gaiser E. 2011. Everglades periphyton: a biogeochemical perspective. Critical Reviews in Environmental Science and Technology 41:309−343 doi: 10.1080/10643389.2010.531218

    CrossRef   Google Scholar

    [16] Shahzad K, Mahmood S, Khalid A, Amir RM, Nawaz R, et al. 2025. Periphyton biofilms formulation and application for the removal of trace pollutants from water. International Biodeterioration & Biodegradation 198:106003 doi: 10.1016/j.ibiod.2025.106003

    CrossRef   Google Scholar

    [17] Godwin CM, Hietala DC, Lashaway AR, Narwani A, Savage PE, et al. 2017. Algal polycultures enhance coproduct recycling from hydrothermal liquefaction. Bioresource Technology 224:630−638 doi: 10.1016/j.biortech.2016.11.105

    CrossRef   Google Scholar

    [18] Wu Y, Liu J, Rene ER. 2018. Periphytic biofilms: a promising nutrient utilization regulator in wetlands. Bioresource Technology 248:44−48 doi: 10.1016/j.biortech.2017.07.081

    CrossRef   Google Scholar

    [19] Sabater S, Guasch H, Ricart M, Romaní A, Vidal G, et al. 2007. Monitoring the effect of chemicals on biological communities. The biofilm as an interface. Analytical and Bioanalytical Chemistry 387:1425−1434 doi: 10.1007/s00216-006-1051-8

    CrossRef   Google Scholar

    [20] Vadeboncoeur Y, Steinman AD. 2002. Periphyton function in lake ecosystems. The Scientific World Journal 2:923031 doi: 10.1100/tsw.2002.294

    CrossRef   Google Scholar

    [21] Zhang Q, Wang B, Feng Y, Feng Y, Li J, et al. 2023. Process water from hydrothermal carbonization: the impacts on the aquatic dissolved organic matter feature and microbial network at the soil-water interface. Journal of Cleaner Production 397:136486 doi: 10.1016/j.jclepro.2023.136486

    CrossRef   Google Scholar

    [22] He H, Wang B, Wu J, Han L, Xie H, et al. 2022. Efficient disposal of the aqueous products of wet organic waste hydrothermal carbonization by paddy constructed wetlands. ACS ES&T Engineering 2:1651−1664 doi: 10.1021/acsestengg.2c00056

    CrossRef   Google Scholar

    [23] Li Q, Wang B, Zhang Q, Huang J, Ding S, et al. 2022. Water quality and periphyton functional response to input of dissolved manure-derived hydrochars (DHCs). Journal of Environmental Management 318:115541 doi: 10.1016/j.jenvman.2022.115541

    CrossRef   Google Scholar

    [24] Xu H, Chen T, Shan Y, Chen K, Ling N, et al. 2024. Recycling food waste to agriculture through hydrothermal carbonization sustains food-energy-water nexus. Chemical Engineering Journal 496:153710 doi: 10.1016/j.cej.2024.153710

    CrossRef   Google Scholar

    [25] Gilcreas FW. 1966. Standard methods for the examination of water and waste water. American Journal of Public Health and the Nations Health 56:387−388 doi: 10.2105/AJPH.56.3.387

    CrossRef   Google Scholar

    [26] Wang L, Delgado-Baquerizo M, Wang D, Isbell F, Liu J, et al. 2019. Diversifying livestock promotes multidiversity and multifunctionality in managed grasslands. Proceedings of the National Academy of Sciences of the United States of America 116:6187−6192 doi: 10.1073/pnas.1807354116

    CrossRef   Google Scholar

    [27] Zhu L, Luan L, Chen Y, Wang X, Zhou S, et al. 2024. Community assembly of organisms regulates soil microbial functional potential through dual mechanisms. Global Change Biology 30:e17160 doi: 10.1111/gcb.17160

    CrossRef   Google Scholar

    [28] Malard LA, Mod HK, Guex N, Broennimann O, Yashiro E, et al. 2022. Comparative analysis of diversity and environmental niches of soil bacterial, archaeal, fungal and protist communities reveal niche divergences along environmental gradients in the Alps. Soil Biology and Biochemistry 169:108674 doi: 10.1016/j.soilbio.2022.108674

    CrossRef   Google Scholar

    [29] Jiao S, Qi J, Jin C, Liu Y, Wang Y, et al. 2022. Core phylotypes enhance the resistance of soil microbiome to environmental changes to maintain multifunctionality in agricultural ecosystems. Global Change Biology 28:6653−6664 doi: 10.1111/gcb.16387

    CrossRef   Google Scholar

    [30] Liang D, Wang Q, Wei N, Tang C, Sun X, et al. 2020. Biological indicators of ecological quality in typical urban river-lake ecosystems: the planktonic rotifer community and its response to environmental factors. Ecological Indicators 112:106127 doi: 10.1016/j.ecolind.2020.106127

    CrossRef   Google Scholar

    [31] Garland G, Banerjee S, Edlinger A, Miranda Oliveira E, Herzog C, et al. 2021. A closer look at the functions behind ecosystem multifunctionality: a review. Journal of Ecology 109:600−613 doi: 10.1111/1365-2745.13511

    CrossRef   Google Scholar

    [32] Albay M, Akçaalan R. 2008. Effects of water quality and hydrologic drivers on periphyton colonization on Sparganium erectum in two Turkish lakes with different mixing regimes. Environmental Monitoring and Assessment 146:171−181 doi: 10.1007/s10661-007-0069-5

    CrossRef   Google Scholar

    [33] Carrillo-Angeles IG, Suzán-Azpiri H, Mandujano MC, Golubov J, Martínez-Ávalos JG. 2016. Niche breadth and the implications of climate change in the conservation of the genus Astrophytum (Cactaceae). Journal of Arid Environments 124:310−317 doi: 10.1016/j.jaridenv.2015.09.001

    CrossRef   Google Scholar

    [34] Costa-Pereira R, Araújo MS, Souza FL, Ingram T. 2019. Competition and resource breadth shape niche variation and overlap in multiple trophic dimensions. Proceedings of the Royal Society B: Biological Sciences 286:20190369 doi: 10.1098/rspb.2019.0369

    CrossRef   Google Scholar

    [35] Bukaveckas P, Shaw W. 1998. Phytoplankton responses to nutrient and grazer manipulations among northeastern lakes of varying pH. Canadian Journal of Fisheries and Aquatic Sciences 55:958−966 doi: 10.1139/f97-293

    CrossRef   Google Scholar

    [36] Pratiwi NTM, Tajudin R. 2011. Photosynthesis of periphyton and diffusion process as source of oxygen in rich-riffle upstream waters. Microbiologi Indonesia 5:182−186 doi: 10.5454/mi.5.4.5

    CrossRef   Google Scholar

    [37] Hayashi M, Vogt T, Mächler L, Schirmer M. 2012. Diurnal fluctuations of electrical conductivity in a pre-alpine river: effects of photosynthesis and groundwater exchange. Journal of Hydrology 450−451:93−104 doi: 10.1016/j.jhydrol.2012.05.020

    CrossRef   Google Scholar

    [38] Lu H, Wan J, Li J, Shao H, Wu Y. 2016. Periphytic biofilm: a buffer for phosphorus precipitation and release between sediments and water. Chemosphere 144:2058−2064 doi: 10.1016/j.chemosphere.2015.10.129

    CrossRef   Google Scholar

    [39] Beheshti M, Alikhani HA, Pourbabaee AA, Etesami H, Asadi Rahmani H, et al. 2021. Periphytic biofilm and rice rhizosphere phosphate-solubilizing bacteria and fungi: a possible use for activating occluded P in periphytic biofilms in paddy fields. Rhizosphere 19:100395 doi: 10.1016/j.rhisph.2021.100395

    CrossRef   Google Scholar

    [40] Li JY, Deng KY, Cai SJ, Lu HL, Xu RK. 2020. Periphyton has the potential to increase phosphorus use efficiency in paddy fields. Science of The Total Environment 720:137711 doi: 10.1016/j.scitotenv.2020.137711

    CrossRef   Google Scholar

    [41] Sun P, Chen Y, Liu J, Xu Y, Zhou L, et al. 2022. Periphytic biofilms function as a double-edged sword influencing nitrogen cycling in paddy fields. Environmental Microbiology 24:6279−6289 doi: 10.1111/1462-2920.16277

    CrossRef   Google Scholar

    [42] Wu Y, Yang J, Tang J, Kerr P, Wong PK. 2017. The remediation of extremely acidic and moderate pH soil leachates containing Cu (II) and Cd (II) by native periphytic biofilm. Journal of Cleaner Production 162:846−855 doi: 10.1016/j.jclepro.2017.06.086

    CrossRef   Google Scholar

    [43] Feng Z, Li N, Deng Y, Yu Y, Gao Q, et al. 2024. Biogeography and assembly processes of abundant and rare soil microbial taxa in the southern part of the Qilian Mountain National Park, China. Ecology and Evolution 14:e11001 doi: 10.1002/ece3.11001

    CrossRef   Google Scholar

    [44] Jiao S, Chen W, Wang J, Du N, Li Q, et al. 2018. Soil microbiomes with distinct assemblies through vertical soil profiles drive the cycling of multiple nutrients in reforested ecosystems. Microbiome 6:146 doi: 10.1186/s40168-018-0526-0

    CrossRef   Google Scholar

    [45] Davis SC, Cerra J, Williams LE. 2024. Comparative genomics of obligate predatory bacteria belonging to phylum Bdellovibrionota highlights distribution and predicted functions of lineage-specific protein families. mSphere 9:e00680-24 doi: 10.1128/msphere.00680-24

    CrossRef   Google Scholar

    [46] Li H, Yang S, Semenov MV, Yao F, Ye J, et al. 2021. Temperature sensitivity of SOM decomposition is linked with a K-selected microbial community. Global Change Biology 27:2763−2779 doi: 10.1111/gcb.15593

    CrossRef   Google Scholar

    [47] Yang H, Cao Y, Zhang W, Pacheco JP, Liu T, et al. 2025. Prokaryotic and eukaryotic periphyton responses to warming, nutrient enrichment and small omnivorous fish: a shallow lake mesocosms experiment. Environmental Research 269:120942 doi: 10.1016/j.envres.2025.120942

    CrossRef   Google Scholar

    [48] Louca S, Parfrey LW, Doebeli M. 2016. Decoupling function and taxonomy in the global ocean microbiome. Science 353:1272−1277 doi: 10.1126/science.aaf4507

    CrossRef   Google Scholar

    [49] Wieczorek AS, Hetz SA, Kolb S. 2014. Microbial responses to chitin and chitosan in oxic and anoxic agricultural soil slurries. Biogeosciences 11:3339−3352 doi: 10.5194/bg-11-3339-2014

    CrossRef   Google Scholar

    [50] Luan L, Jiang Y, Cheng M, Dini-Andreote F, Sui Y, et al. 2020. Organism body size structures the soil microbial and nematode community assembly at a continental and global scale. Nature Communications 11:6406 doi: 10.1038/s41467-020-20271-4

    CrossRef   Google Scholar

    [51] Feng Y, Chen R, Stegen JC, Guo Z, Zhang J, et al. 2018. Two key features influencing community assembly processes at regional scale: Initial state and degree of change in environmental conditions. Molecular Ecology 27:5238−5251 doi: 10.1111/mec.14914

    CrossRef   Google Scholar

    [52] Sun Y, Li X, Cao N, Duan C, Ding C, et al. 2022. Biodegradable microplastics enhance soil microbial network complexity and ecological stochasticity. Journal of Hazardous Materials 439:129610 doi: 10.1016/j.jhazmat.2022.129610

    CrossRef   Google Scholar

    [53] Yu Y, Wu M, Petropoulos E, Zhang J, Nie J, et al. 2019. Responses of paddy soil bacterial community assembly to different long-term fertilizations in southeast China. Science of The Total Environment 656:625−633 doi: 10.1016/j.scitotenv.2018.11.359

    CrossRef   Google Scholar

    [54] Li Z, He J, Shen J, Li Y, Yuan Q, et al. 2025. Origin and assembly characteristics of periphyton microbes in subtropical paddy fields: a case study in Tuojia catchment in Southern China. Applied Soil Ecology 206:105839 doi: 10.1016/j.apsoil.2024.105839

    CrossRef   Google Scholar

    [55] Lu H, Feng Y, Wang J, Wu Y, Shao H, et al. 2016. Responses of periphyton morphology, structure, and function to extreme nutrient loading. Environmental Pollution 214:878−884 doi: 10.1016/j.envpol.2016.03.069

    CrossRef   Google Scholar

    [56] Hillebrand H, Kahlert M. 2001. Effect of grazing and nutrient supply on periphyton biomass and nutrient stoichiometry in habitats of different productivity. Limnology and Oceanography 46:1881−1898 doi: 10.4319/lo.2001.46.8.1881

    CrossRef   Google Scholar

    [57] Wang D, Deng S, Wang J, Feng Q, Liu J, et al. 2024. Soil micro-food web complexity drives soil multifunctionality along an elevation gradient. CATENA 246:108464 doi: 10.1016/j.catena.2024.108464

    CrossRef   Google Scholar

    [58] Luo W, Wang P, Liu J, Tao J. 2025. Microbial keystone taxa and network complexity, rather than diversity, sustain soil multifunctionality along an elevational gradient in a subtropical karst mountain. CATENA 256:109115 doi: 10.1016/j.catena.2025.109115

    CrossRef   Google Scholar

    [59] Yuan Z, Ali A, Loreau M, Ding F, Liu S, et al. 2021. Divergent above- and below-ground biodiversity pathways mediate disturbance impacts on temperate forest multifunctionality. Global Change Biology 27:2883−2894 doi: 10.1111/gcb.15606

    CrossRef   Google Scholar

  • Cite this article

    Zhong X, Wang B, Sun K, Xie H, Tian W, et al. 2025. Sludge-derived hydrothermal carbonization aqueous phase regulates agro-ecosystem multifunctionality by affecting cross-trophic community in periphyton. Agricultural Ecology and Environment 1: e011 doi: 10.48130/aee-0025-0012
    Zhong X, Wang B, Sun K, Xie H, Tian W, et al. 2025. Sludge-derived hydrothermal carbonization aqueous phase regulates agro-ecosystem multifunctionality by affecting cross-trophic community in periphyton. Agricultural Ecology and Environment 1: e011 doi: 10.48130/aee-0025-0012

Figures(6)

Article Metrics

Article views(3019) PDF downloads(745)

Original Research   Open Access    

Sludge-derived hydrothermal carbonization aqueous phase regulates agro-ecosystem multifunctionality by affecting cross-trophic community in periphyton

Agricultural Ecology and Environment  1 Article number: e011  (2025)  |  Cite this article

Abstract: Hydrothermal carbonization (HTC) is an efficient sludge conversion technology that generates a nutrient- and dissolved organic matter-rich aqueous phase (HAP) with potential for agricultural reuse. Given its intended application, evaluating the ecological effects of HAP on soil-water interface bio-processes in agroecosystems is critically important. This study employed periphyton as a model system to assess its functional responses to sludge-derived HAP at different concentrations, innovatively investigating the role of cross-trophic interactions as a central mediator. Physicochemical parameters were systematically monitored throughout the cultivation, as well as the bacterial and eukaryotic communities. The results demonstrate that periphyton maintained notable nutrient removal capacity even under high HAP stress, with removal rates remaining up to 55% for COD, and 35% for NH4+-N at the highest HAP input level. However, this capacity decreased with increasing HAP concentration. While microbial α-diversity remained stable, HAP significantly reshaped the species composition and community structure of both bacteria and eukaryota (p < 0.05), primarily driven by shifts in trophic guilds and environmental factors. It was found that HAP reduced the periphyton's ecological multifunctionality by narrowing its niche breadth and simplifying the interdomain network architecture, highlighting a previously underappreciated mechanism. Notably, the findings also reveal that HAP induced adaptive regulatory and functional compensation strategies in periphyton, maintaining nutrients removal through reorganization of trophic guilds and functional groups. This study provides novel insights into the ecological risk assessment of HAP and supports the development of sustainable management strategies for its agricultural application.

    • Hydrothermal carbonization (HTC) has emerged as a highly efficient technology for treating high-moisture organic waste, such as sludge from municipal wastewater treatment, due to its ability to bypass feedstock drying, operate under mild conditions, and produce hydrochar suitable for use as fuel or soil conditioner[1,2]. With increasing practical implementation, HTC technology is increasingly recognized as a viable solution to the growing challenge of sludge management in wastewater treatment[35]. However, a major byproduct of the process is the hydrothermal carbonization aqueous phase (HAP), into which 20%–50% of the organic matter, and 60%–80% of nitrogen (N) and phosphorus (P) are solubilized during the reaction[6]. The effective utilization of this nutrient-rich HAP remains a challenge to the full industrialization of HTC.

      Despite this challenge, HAP exhibits significant potential for agricultural reuse. Its high organic matter content and N richness enable its use as a soil amendment, with studies demonstrating that appropriate application can reduce fertilizer usage and ammonia volatilization, while improving crop yield and quality[79]. Additionally, HAP serves as a valuable nutrient source for microalgae cultivation[10], offering a sustainable pathway for nutrient recovery and contaminant removal strategies, widely regarded as promising for circular resource management[11]. Nevertheless, HAP may exert both beneficial and adverse effects on agroecosystems, necessitating a thorough evaluation of its environmental implications. To date, however, a comprehensive understanding of HAP's impact on agroecosystems remains limited and fragmented[1214].

      Periphyton, a complex and multi-trophic assemblage of autotrophic and heterotrophic microorganisms (e.g., algae, bacteria, and fungi), forms structured biofilms where these organisms are interconnected and thrive within a matrix of extracellular polymeric substances, organic matter, and debris[15]. Ubiquitous in aquatic environments such as paddy fields and lakes, this biofilm ecosystem is not only a key driver of primary production but also plays essential roles in nutrient cycling, food web dynamics, and the removal of contaminants from the water column[16]. Moreover, periphyton exhibits high sensitivity to environmental perturbations, dynamically adjusting its biomass, community structure, and metabolic activity in response to stressors. As such, it is widely employed as a sensitive bioindicator in environmental monitoring, ecotoxicological assessments, and ecological remediation[1719]. In particular, periphyton biomass serves as a reliable bioindicator for assessing dissolved organic matter content and nutrient characteristics within shallow water bodies[20]. Previous studies have shown that periphyton can facilitate the degradation of HAP in paddy systems, concurrently undergoing structure reorganization of its microbial network, thereby demonstrating adaptive responses to HAP exposure[2123]. These findings position periphyton as a sensitive and ecologically relevant model system for assessing the impacts of HAP. Crucially, there is still insufficient systematic evidence connecting HAP-driven shifts in periphyton community structure to broader shifts in ecological multifunctionality, microbial network interactions, and metabolic pathways.

      To address these knowledge gaps, a microcosm experiment was conducted to systematically examine the effects of gradient HAP inputs on periphyton, with a focus on the following primary objectives: to quantify the reshaping of taxonomic and trophic structure; to evaluate the resulting alterations in interdomain microbial networks; and to assess the ultimate impact on agro-ecosystem multifunctionality. By integrating high-throughput sequencing, network analysis, and metabolic prediction, this study aims to elucidate the mechanistic links between HAP exposure and ecological functional outcomes, providing a scientific basis for risk assessment and sustainable application of HAP in agriculture.

    • Sludge was collected from a municipal wastewater treatment plant (Nanjing, China). The solid-to-liquid ratio was adjusted to 1:10, and the mixture was treated in a 10 L hydrothermal reactor at 220 °C for 1 h. After cooling to room temperature, solid-liquid separation was performed. The liquid product, designated as sludge-derived HAP, was stored in a cool place for subsequent use. The fundamental physicochemical properties of the HAP are presented in Supplementary Table S1.

    • Periphyton was collected from a lake in Nanjing (China). Periphyton inoculum was prepared and pre-cultured according to the method described in a previous study[23]. As outlined in Supplementary Table S2, HAP and water were mixed at different ratios to form three treatments labeled H, M, and L. The concentration gradient was established based on methodologies reported in previous studies[24]. Periphyton inoculum was then added to each group. A control group (CK) containing only pond water was also established. Each treatment was conducted in triplicate.

      The cultivation process was carried out in an illuminated incubator at 28 °C under a 12-h light/12-h dark cycle. During cultivation, water samples were periodically collected and filtered through a 0.45 μm membrane. The pH and dissolved oxygen (DO) of the filtered water were measured using a pH meter and a DO meter, respectively. Total nitrogen (TN), total phosphorus (TP), and chemical oxygen demand (COD) were determined following standard methods[25]. The concentration of NH4+-N was measured using Nessler's reagent spectrophotometry. At the end of the incubation period, periphyton samples were collected, dried at 105 °C, and weighed to determine biomass.

    • Periphyton samples were sent to Personalbio Biotechnology Company (Shanghai, China) for microbial community diversity profiling and library construction. The V5–V7 regions of the bacterial 16S rRNA gene were amplified using primers 799F (AACMGGATTAGATACCCK) and 1193R (ACGTCATCCCCACCTTCC). The V9 region of the eukaryotic 18S rRNA gene was amplified using primers Euk1391f (GTACACACCGCCCGTC) and EukBr (TGATCCTTCTGCAGGTTCACCTAC).

      DNA fragments from the microbial communities were subjected to paired-end sequencing on the Illumina platform. The Good's coverage index for all samples exceeded 99.5%, indicating high sequencing coverage and reliability. QIIME2 (2019.4) was used for annotation, analysis, clustering, and taxonomic classification of species at consistent sequencing depths. Relative abundance and diversity indices were calculated using the Greengenes database for bacteria and a customized database for eukaryota. Fungal trophic modes and bacterial ecological functions were annotated using the FUNGuild and FAPROTAX databases, respectively. Metabolic pathways of bacterial and eukaryotic communities were predicted using PICRUSt2 (Phylogenetic Investigation of Communities by Reconstruction of Unobserved States).

    • The microbial α-diversity was calculated using the 'vergan' package. Non-metric multidimensional scaling (NMDS) based on Bray-Curtis distance was applied to assess changes in microbial community structure across groups. Distance-based redundancy analysis (dbRDA) was also performed based on Bray-Curtis distance using the 'microeco' package. Linear discriminant analysis Effect Size (LEfSe) analysis was conducted with the 'microeco' package. The influence of various environmental factors on community composition was quantified using the 'rdacca.hp' package. To obtain a single index reflecting multitrophic diversity (multidiversity), the biodiversity characteristics were combined by averaging the standardized scores [using minimum-maximum (min-max) normalization] of Chao1 indices across bacterial and eukaryotic species[26].

    • The normalized stochasticity ratio (NST) was used to estimate the relative importance of stochastic processes in community assembly. The NST value for each treatment was computed with the 'NST' package[27]. An NST value of 0.5 served as the threshold to distinguish between more deterministic (< 0.5), and more stochastic (> 0.5) assembly processes. Niche breadth was measured using Levins' index, implemented via the 'spaa' package[28].

      Interdomain bipartite networks were constructed for each group using the 'ggClusterNet' package, and visualized in Gephi 0.10.1 to assess cross-trophic microbial interactions. Topological properties of the networks—including average degree, connectivity, average path length, and network density—were computed with the 'igraph' package. To reflect overall network complexity, a composite index was derived by averaging the normalized scores (ranging from 0 to 1) of these topological metrics. Notably, the average path length (reflecting network sparsity) was inverted before normalization[29].

    • To emphasize the influence of the incubation process on ecosystem functioning, an ecosystem multifunctionality (MF) index was constructed based on processes related to nutrient cycling and growth metabolism, including the concentrations of DO and NH4+-N, the nitrogen-to-phosphorus (N/P) ratio, the concentration of COD, and biomass. These metrics are widely used to evaluate ecological quality in natural aquatic ecosystems[30]. Notably, to characterize the balance between periphyton nitrogen-phosphorus demand and environmental supply, the stoichiometric ratio of N/P was employed instead of absolute N and P concentrations. Following recommendations in the literature, pH was excluded from the MF calculation as it is not a strong proxy for ongoing ecosystem processes[31]. Furthermore, to avoid interference from nutrients inherently present in HAP, the MF index was computed using the relative change ratio, rather than absolute concentrations, for water physicochemical properties. An exception was made for DO, which was treated separately due to its distinct response pattern characterized by photosynthesis-driven increases. This procedure was implemented using the 'multifunc' package.

      All statistical analyses were performed in R 4.3.2. Data visualization was carried out using GraphPad Prism 9.5 and Adobe Illustrator 2025.

    • The addition of HAP rapidly altered the physicochemical properties of the water. Throughout the periphyton incubation, water quality indicators exhibited distinct dynamics. The introduction of HAP influenced the initial DO and pH levels of the system. DO was sharply suppressed, especially in the H group (minimum: 0.19 mg/L), while pH remained around 8 (Supplementary Fig. S1a, S1b). During incubation, DO levels gradually increased due to natural re-aeration and oxygen production from periphyton photosynthesis. However, the recovery of DO was slower in treatments with higher HAP content. After day 9, both DO and pH in all treatments recovered to levels comparable to those in the CK.

      In contrast to the stable, low N levels in the CK group, the addition of HAP introduced a substantial initial load of N, as evidenced by the sharp rise in both NH4+-N and TN concentrations. These nitrogen concentrations decreased progressively over time (Supplementary Fig. S1c, S1d). By day 15, NH4+-N concentrations had decreased by 90.7% (L), 51.6% (M), and 38.7% (H) compared to their initial values. TN concentrations showed similar intergroup variation patterns to NH4+-N. TP trends and concentrations in the HAP-treated groups were similar to those in CK, with values peaking on day 9 before declining to levels comparable to or even lower than those in CK (Supplementary Fig. S1e).

      COD levels showed a fluctuating downward trend (Supplementary Fig. S1f). The COD in the CK, L, and M groups decreased to low values on day 3, while the H group reached its lowest value on day 6. All groups peaked on day 9 before declining again. By day 15, COD had decreased by 76.9% (CK), 56.9% (L), 64.0% (M), and 55.7% (H), respectively.

    • Periphyton biomass decreased with increasing HAP concentration, indicating that HAP significantly inhibited periphyton growth and reproduction (Supplementary Fig. S2). The α-diversity of bacterial and eukaryotic species in periphyton samples was reflected using the Shannon and Chao1 indices. Bacterial diversity indices were higher than those of eukaryotes. However, no significant differences were observed in the diversity indices of either bacteria or eukaryotes among treatment groups at the end of the incubation period (p > 0.05), suggesting that periphyton α-diversity was not affected by HAP during incubation (Fig. 1a, b). Therefore, subsequent analyses focused on β-diversity. NMDS analysis revealed that both bacterial and eukaryotic communities clustered according to HAP treatment, with clear separations observed between treatment groups and the control (Fig. 1c, d). Higher HAP concentrations resulted in greater distances between sample points and lower similarity, indicating that HAP concentration was a key factor altering the β-diversity of periphyton species.

      Figure 1. 

      HAP alters the community structure but not the alpha diversity of periphyton. (a), (b) Alpha diversity indices (Shannon and Chao1) of bacterial and eukaryotic communities across treatments. 'ns' indicates no significant difference. Non-metric multidimensional scaling (NMDS) ordination showing changes in the (c) overall bacterial, and (d) eukaryotic community structure. Relative abundance of dominant (e) bacterial, and (f) eukaryotic phyla.

      To further analyze the impact of HAP on periphyton species composition, highly abundant taxa (relative abundance > 1% for bacteria and > 0.7% for eukaryotes) were compared (Fig. 1e, f). At the phylum level, the dominant bacterial groups included Proteobacteria, Bdellovibrionota, Firmicutes, Actinobacteria, Planctomycetota, Armatimonadota, and Bacteroidota. Among these, Proteobacteria remained the most abundant phylum across all treatments, with no significant difference induced by HAP addition (p > 0.05). The abundance of Bdellovibrionota increased under HAP influence (p < 0.05), rising from 4.0% (CK) to 27.4% (L), 25.8% (M), and 21.7% (H), respectively. The abundance of Firmicutes decreased with HAP input, particularly in the H group, where it declined significantly from 28.2% (CK) to 1.6% (p < 0.05). The overall relative abundance of Actinobacteria was less affected by HAP.

      As shown in Fig. 1f, the main eukaryotic taxa included Chlorophyta, Mucoromycota, Basidiomycota, Ascomycota, Ciliophora, Apicomplexa, and Bacillariophyta. Chlorophyta was the absolutely dominant group across all treatments, consistent with previously reported periphytic algal community structures in freshwater systems[32]. HAP addition further increased its relative abundance. The abundance of Mucoromycota decreased significantly under HAP influence (p < 0.05), declining from 19.7% (CK) to 9.4% (L), 8.7% (M), and 2.7% (H), respectively. The abundance of Basidiomycota increased significantly under high HAP input, rising from 0.4% (CK) to 9.4% (H) (p < 0.05), while Ascomycota responded positively only to low-level HAP input. LEfSe analysis showed that at a threshold of 4, HAP addition led to the emergence of biomarker species in both bacterial and eukaryotic communities that were distinct from those in the CK group, further demonstrating the capacity of HAP to reshape the relative species composition of periphyton (Supplementary Fig. S3).

    • Niche breadth varied among species and across treatment groups (Fig. 2a, b). The niche breadth of eukaryotic species in the periphyton ranged between 4.90 and 9.8, while bacterial species exhibited a broader range. With increasing HAP concentration, the niche breadth of both eukaryotic and bacterial species decreased to varying degrees, with eukaryotic species showing a significant difference compared to CK (p < 0.05). This observation indicates that eukaryotes exhibited a narrower niche breadth, which aligns with the established ecological principle that reduced niche breadth limits resource access and increases susceptibility to environmental stressors[33,34]. NST was used to characterize the response of bacterial and eukaryotic community assembly to HAP stress. In CK, the mean NST value for bacterial communities was 0.45, indicating that deterministic processes dominated. As HAP concentration increased, the NST values of bacterial communities gradually rose above 0.5, reflecting an increased importance of stochastic processes (Fig. 2c). Similarly, low and high HAP inputs led to elevated NST values in eukaryotic communities, although the addition of medium HAP concentration appeared to reduce the role of deterministic processes (Fig. 2d).

      Figure 2. 

      HAP narrows species' niche breadth and increases stochasticity in community assembly. The average Levins' niche breadth of (a) bacterial, and (b) eukaryotic communities. The normalized stochasticity ratio (NST) of (c) bacterial, and (d) eukaryotic communities. An NST > 0.5 indicates the dominance of stochastic processes.

      To further clarify the impact of HAP on interactions across trophic levels within the periphyton network, interdomain bipartite networks of bacteria and eukaryota were constructed for each group, and their structural and topological indices were computed (Fig. 3a; Supplementary Table S3). Low to medium HAP inputs increased the proportion of negative connections in the network, indicating enhanced competition between bacteria and eukaryotes. The proportion of eukaryotic nodes decreased with increasing HAP concentration. Moreover, in HAP-addition groups, network connectivity, average degree, and network density were all lower than those in CK. These results imply poorer adaptability of eukaryotes to HAP, reduced resistance of bacterial-eukaryotic interactions to external stress, and a decline in network complexity.

      Figure 3. 

      HAP simplifies the architecture of bacteria-eukaryota interdomain networks. (a) Bipartite networks for each treatment. Node color represents taxonomy at the genus level, and size is proportional to node degree. Edges represent significant positive (green) and negative (red) correlations. (b), (c) Major trophic modes of (b) eukaryota, and (c) bacteria are annotated by the FUNGuild and FAPROTAX databases, respectively.

      FUNGuild and FAPROTAX tools were used to annotate the trophic modes and ecological functions of eukaryotic and bacterial nodes within the networks, respectively (Fig. 3b, c). The proportions of connections associated with different trophic types differed among groups (Fig. 4af). Specifically, at 'highly probable' and 'probable' confidence levels, HAP addition increased the proportion of symbiotic nutrition in eukaryotes, while reducing the weight of saprotrophic modes. Chemoheterotrophic bacteria dominated across all networks, and HAP treatment further strengthened this dominance while reducing the connection weight of mixotrophic species. Additionally, HAP increased the connection proportion of nitrogen-fixing bacteria but decreased those involved in nitrate reduction, nitrogen respiration, and denitrification. The weights of fermentative bacteria and chitin-degrading bacteria also declined. Correlation analysis revealed that the connection weights of these functional groups were significantly correlated with interdomain network complexity (p < 0.001), indicating that bacterial trophic types and ecological patterns play crucial roles in periphyton network interactions (Fig. 4g).

      Figure 4. 

      HAP induces a functional reorganization of the periphyton network. The proportion of connections (edges) associated with different (a) bacterial ecological functional groups, and (b)–(f) eukaryotic trophic modes in the interdomain networks. (g) Correlation analysis between the connection proportions of key functional groups and overall network complexity indices.

      Environmental factors, including TP, COD, TN, and AN, also explained a considerable portion of the phylogenetic variation in the periphyton community. Hierarchical partitioning analysis showed that these environmental factors accounted for over 70% of the variance in both eukaryotic and bacterial communities. HAP-induced differences in periphyton composition were significantly correlated with changes in water nutrient levels (p < 0.05) (Fig. 5).

      Figure 5. 

      Water nutrient levels are the primary environmental drivers of periphyton community composition. Distance-based redundancy analysis (dbRDA) of (a) bacterial, and (b) eukaryotic communities. The individual impact of each environmental factors on (c) bacteria, and (d) eukaryota is calculated based on the 'rdacca.hp' package.

    • The mean multifunctionality (MF) of periphyton was calculated. Compared to the CK, HAP addition significantly reduced periphyton MF (p < 0.05), with greater reductions observed at higher HAP concentrations (Fig. 6a).

      Figure 6. 

      Key microbial properties driving the decline of ecosystem multifunctionality under HAP stress. (a) The ecosystem multifunctionality (MF) index across treatments. Linear relationships between MF and the (b) multidiversity, (c) the network complexity, the normalized stochasticity ratio (NST) of (d) bacteria, and (g) eukaryota, the community structure (PCoA axis1) of (e) bacteria, and (h) eukaryota, and the Levins' niche breadth of (f) bacteria, and (i) eukaryota.

      Several microbial indicators showed significant correlations with periphyton MF (p < 0.05) (Fig. 6). The community structures of both eukaryotes and bacteria exhibited highly significant positive effects on MF (p < 0.001). Bipartite network complexity was also significantly positively correlated with MF (R2 = 0.938, p < 0.001). The niche breadth of eukaryota had a significant positive impact on MF. Eukaryotic NST was not linearly related to MF, whereas bacterial NST was significantly negatively correlated with MF (R2 = 0.437, p < 0.05). Multidiversity, calculated based on the richness (Chao1) of bacterial and eukaryotic species, showed no linear relationship with periphyton MF.

    • Metabolic pathways of bacterial and eukaryotic species in the periphyton were predicted using the MetaCyc database, with significantly different pathways (p < 0.05, ANOVA) across groups being selected for further analysis (Supplementary Figs S4, S5). Bacterial biosynthetic pathways exhibited the highest relative abundance in all treatments. Specifically, the relative abundances of pathways related to nucleoside and nucleotide biosynthesis, metabolic regulators, and secondary metabolite synthesis decreased with HAP addition. These pathways generally showed significantly positive correlations with bacterial niche breadth and periphyton multifunctionality, and were negatively correlated with the normalized stochasticity ratio (NST) of bacteria (p < 0.05). A similar trend was observed in other metabolic categories, such as inorganic nutrient metabolism, C1 compound assimilation and utilization, formaldehyde oxidation I, and isopropanol biosynthesis. The reduction in the relative abundance of these pathways may reflect enhanced inhibitory effects of HAP on bacteria, directly influencing species turnover and functional expression within the bacterial community. Notably, HAP addition appeared to enhance the expression of certain bacterial metabolic pathways, including the glyoxylate cycle and amino acid degradation.

      In eukaryotic communities, pathways for the generation of precursor metabolites and energy ranked second in relative abundance after biosynthesis (Supplementary Fig. S5). HAP addition reduced the expression of respiratory and electron transfer pathways, while promoting increased relative abundance in glycolysis and the pentose phosphate pathway. These significant alterations indicate that HAP also profoundly affects metabolic processes in eukaryotic species within the periphyton, thereby influencing community assembly. Correlations between eukaryotic NST values and metabolic pathways were generally weak, suggesting that stochastic processes play a minor role in shaping the metabolic functional expression of eukaryotes.

    • Physicochemical properties of water are critical indicators for assessing periphyton responses to external stressors and are essential for understanding the interactions between periphyton and the ecosystem. Among them, pH is an important factor regulating nutrient availability and may serve as one of the driving forces for microbial communities in ecosystems[35]. The results indicate that metabolic and reproductive activities of periphyton led to a noticeable increase in water pH during cultivation. This effect can be primarily attributed to the phototrophic algae that dominate periphytic biofilms, whose intense photosynthetic activity consumes dissolved CO2 and releases oxygen, thereby elevating the pH of the water[36,37]. Consistent with this mechanism, Lu et al.[38] observed a marked increase in pH in periphyton-containing waters, which promotes the co-precipitation of phosphorus. In another homothermal incubation experiment, Beheshti et al.[39] observed increased soil pH after 50 d of periphyton treatment. In the present study, no significant differences in pH were observed among treatment groups at the end of the cultivation period (Fig. 1a). A possible explanation is that HAP addition did not significantly affect the intensity of photosynthesis in periphyton.

      In this study, the TP content in water increased initially and then decreased. During the early incubation stage, P limitation may have led to the decomposition of periphyton, releasing assimilated and stored soluble P back into the water[40]. Over time, the elevated pH will accompany the precipitation and fixation of P in nutrient-rich water, which is considered an important mechanism by which periphyton mitigates P loss[38]. Across different HAP concentrations, periphyton demonstrated certain N removal capabilities from the sludge-derived HAP. A previous study has shown that periphyton plays a key role in the biogeochemistry of N in aquatic environments, exhibiting potential for intercepting and accumulating N[41]. Due to the stress effects of HAP on periphyton, the percentage reduction in TN and NH4+-N decreased with increasing HAP concentration. Similarly, high concentrations of HAP also adversely affected the removal of COD by periphyton. Nevertheless, within the incubation period, all treatment groups achieved reduction rates of over 45% for both TN and COD, indicating considerable short-term tolerance and adaptability of periphyton to HAP. A previous study has suggested that the functional diversity of periphyton is an important factor enabling its rapid adaptation to and efficient utilization of nutrients in high-nutrient water[42]. In summary, the tolerance of periphyton to HAP across concentration gradients can buffer the environmental risks posed by HAP to the ecosystem, yet it is insufficient to fully counteract them.

    • Understanding the species composition and community differences of periphyton is crucial for studying its ecological functions. The observed decrease in periphyton biomass with increasing HAP concentration indicates strong inhibitory effects of HAP on periphyton growth. After incubation, no significant differences in the α-diversity of bacterial and eukaryotic species were detected among groups, possibly due to the high diversity of species within periphyton, particularly rare taxa[43]. However, significant dissimilarities in community composition between samples suggest that HAP induced community reassembly and shifts in dominant species, likely attributable to altered ecological niches[44]. For bacteria, HAP promoted an increase in Bdellovibrionota, which are obligate predators known to prey on other bacteria for growth[45]. For eukaryotic species, HAP suppressed the activity of Mucoromycota, a group of saprophytic fungi that typically occupy nutrient-rich niches and utilize nutrients efficiently[46]. Under HAP stress, both bacterial and eukaryotic species exhibited specialized resource use strategies, leading to an increase in the abundance of specialist taxa. This may represent an adaptive response to harsh conditions, resulting in reduced metabolic flexibility at the taxonomic level and a consequent decrease in overall niche breadth for both bacteria and eukaryotes. Narrow niche breadth may also increase the vulnerability of interspecific relationships within periphyton[28]. For instance, HAP addition reduced interdomain network complexity (Supplementary Table S3), consistent with findings by Yang et al., who reported a significant decline in prokaryotic network density in periphyton under anthropogenic nutrient enrichment[47]. Given the naturally low nutrient levels in the water, periphyton's reliance on HAP as a singular nutrient source may exacerbate community homogenization, undermining community stability and the maintenance of complex systems (Supplementary Fig. S6).

    • HAP also induced differences in cooperation among species of different trophic types within periphyton, which is an important factor altering community assembly processes. At the taxonomic level, high functional redundancy resulting from vast species diversity may interfere with the interpretation of community differences[48]. Groupings based on trophic modes and ecological functions are often more sensitive to environmental changes, providing deeper insights into how HAP concentration gradients drive community assembly. Ureolysis and biological N fixation are considered major pathways for periphyton to assimilate external N sources and achieve N accumulation[41]. In this study, the connection weights of these functional nitrogen-accumulating bacteria in the interdomain network increased with higher HAP concentrations. Meanwhile, chitin-degrading bacteria facilitate the conversion of nitrogenous organic matter into nitrate[49]. These enhanced interdomain cooperative relationships may help maintain relatively stable N accumulation pathways in periphyton, offering clear adaptive advantages under high-nutrient HAP inputs. Despite overall constraints on interdomain cooperation under HAP stress, periphyton may achieve functional compensation by altering the weight distribution of trophic guilds within the network. This allows periphyton to sustain nutrient uptake and fixation capacities under environmental pressure, avoiding community collapse.

      Previous studies have categorized the core mechanisms of microbial community assembly into deterministic and stochastic processes[50]. Due to their larger body size, eukaryotic communities exhibit lower stochasticity in assembly than bacteria, as reflected in their lower NST values. Under HAP addition, stochastic processes gradually dominated bacterial community assembly. The imbalanced nutrients and potential toxic substances introduced by HAP may stress the environment and act as a filter during periphyton community assembly. The remaining species face reduced competition, potentially enhancing their ability to cope with environmental stress and increasing the relative importance of stochasticity in shaping the final community composition. Moreover, the introduction of additional carbon sources may promote community homogenization and enhance bacterial dispersal capacity[51,52]. A previous study has also reported that increased nutrient availability can introduce greater stochasticity into microbial community assembly[53].

      The assembly of bacterial and eukaryotic communities in periphyton is also influenced by various environmental factors. Previous research has shown that the physicochemical properties of the growth substrate can lead to differences in community assembly[54]. However, the characteristics of the overlying water should not be overlooked, particularly the availability of N and P, which may determine periphyton community composition[55]. In this study, TP and TN had the highest explanatory power for both bacterial and eukaryotic communities, supporting the important role of N and P in shaping periphyton community structure. The extremely high TN content in HAP may cause an imbalance in N/P ratios. In the absence of substrate-mediated regulation, periphyton may experience P limitation[56].

      In summary, the assembly of the periphyton community was co-driven by cross-trophic collaborations and nutrient characteristics of the overlying water. Throughout this process, the compensatory reorganization of the community to safeguard core functions, such as N metabolism, was a key factor in its adaptability to HAP.

    • The results indicate significant positive correlations between community structure, interdomain network complexity, and periphyton multifunctionality (Fig. 6, p < 0.01), highlighting the importance of community assembly and interspecies cooperation in expressing multifunctionality[57]. Furthermore, eukaryotic niche breadth had a more pronounced impact on multifunctionality, suggesting that the resource acquisition capacity of eukaryotes is closely linked to the maintenance of community functions. Broader niche breadth may serve as a predictor of core species involved in expressing diverse traits[29]. Under HAP stress, broad-niche species may disproportionately influence periphyton multifunctionality[58]. Numerous studies have identified species diversity as a key driver of multifunctionality in many terrestrial ecosystems, with increased diversity enhancing ecosystem multifunctionality[59]. Although this linear relationship was not significant in the present study, the contribution of species diversity to multifunctionality should not be overlooked, as such relationships may be modulated by abiotic factors such as environmental conditions. Additionally, the contribution of protists within periphyton was not considered in this study and should be addressed in future research.

      HAP also influenced multifunctionality by reshaping the metabolic pathways of periphyton. Significant suppression of bacterial biosynthetic pathways—particularly those related to nucleotides, secondary metabolites, and inorganic nutrient metabolism—weakened core functions generally associated with broad niche breadth. The decline in the abundance of these pathways was closely linked to reduced ecological multifunctionality, indicating an overall loss of functional regulation. In contrast, the suppression of respiratory pathways and enhancement of glycolysis and pentose phosphate pathways in eukaryotes suggest a compensatory yet less efficient energy maintenance strategy. Notably, the relative abundance of amino acid degradation pathways was negatively correlated with multifunctionality in both bacteria and eukaryotes. One possible explanation is that HAP inhibited bacterial synthetic capacity while forcing eukaryotes into a metabolically simplified state. This may reflect a commonly adopted strategy to adapt to environmental stress.

      Overall, the complexity of community interactions, rather than species diversity alone, served as the primary driver of multifunctionality. Moreover, metabolic pathways appear to provide a robust predictive framework for assessing the ecological multifunctionality of periphyton.

    • This study demonstrates that when sludge-derived HAP serves as a potential nutrient source, it may also act as a significant environmental stressor to periphyton. Periphyton's adaptability and nutrient removal capacity make it promising for cleaning HAP-input water. However, the environmental risks of using HAP in agriculture must be carefully assessed because HAP impairs ecosystem functioning by altering species composition, narrowing niche breadth in key taxa, and simplifying interdomain ecological networks. These changes directly reduce ecosystem multifunctionality. Under the anthropogenic stress posed by HAP, microbial community structure and interactions are more reliable predictors of function than species richness alone. Although periphyton adapts by reorganizing trophic guilds and shifting its metabolism, this response cannot fully offset the functional losses under high HAP levels.

      The microcosm experiment, while controlled, may not fully capture the complexity of natural agricultural systems; therefore, the long-term effects of repeated HAP application on periphyton and agriculture ecosystem stability should be investigated more deeply in future research.

      • Not applicable.

      • The authors confirm their contributions to the paper as follows: Huifang Xie: writing−review and editing, supervision; Xudong Zhong: writing−original draft, visualization, methodology, investigation, data curation; Bingyu Wang: writing−review and editing, supervision, conceptualization, funding acquisition, software, resources, project administration, methodology; Ke Sun: investigation; Wenlu Tian: methodology, investigation; Yanfang Feng: writing−review and editing. All authors reviewed the results and approved the final version of the manuscript.

      • The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

      • This work was supported by the National Key Research and Development Program of China (Grant No. 2024YFD1700300), and the National Natural Science Foundation of China (Grant Nos 42107398 and 42277332). Yanfang Feng thanks the support of the '333' High-level Talents Training Project of Jiangsu Province (Grant No. 2022-3-23-083).

      • The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

      • # Authors contributed equally: Xudong Zhong, Bingyu Wang
        Full list of author information is available at the end of the article.

      • Copyright: © 2025 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (6)  References (59)
  • About this article
    Cite this article
    Zhong X, Wang B, Sun K, Xie H, Tian W, et al. 2025. Sludge-derived hydrothermal carbonization aqueous phase regulates agro-ecosystem multifunctionality by affecting cross-trophic community in periphyton. Agricultural Ecology and Environment 1: e011 doi: 10.48130/aee-0025-0012
    Zhong X, Wang B, Sun K, Xie H, Tian W, et al. 2025. Sludge-derived hydrothermal carbonization aqueous phase regulates agro-ecosystem multifunctionality by affecting cross-trophic community in periphyton. Agricultural Ecology and Environment 1: e011 doi: 10.48130/aee-0025-0012

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return