Search
2025 Volume 5
Article Contents
ARTICLE   Open Access    

Characterisation of early fruit development-specific miRNAs and their targets in peach using small RNA and degradome sequencing

More Information
  • Received: 15 March 2023
    Revised: 28 February 2025
    Accepted: 05 March 2025
    Published online: 26 May 2025
    Fruit Research  5 Article number: e021 (2025)  |  Cite this article
  • Peach (Prunus persica L.) is a key drupe fruit crop characterized by a double-sigmoid growth pattern during fruit development. MicroRNAs (miRNAs) play pivotal regulatory roles in this process; however, their functions in early peach fruit development remain poorly understood. To address this, we conducted high-throughput small RNA (sRNA) sequencing at three critical developmental stages: 20, 50, and 75 d post-anthesis (DPA20, DPA50, DPA75), representing exponential growth, lag phase, and rapid regrowth, respectively. We identified 124 known miRNAs from 70 families and 86 novel miRNAs, with 97 and 79 miRNAs differentially expressed between DPA50 vs DPA20 and DPA75 vs DPA50, respectively. Degradome sequencing revealed 216 target genes for 74 known and eight novel miRNAs, with targets of ppe-miR160a and ppe-miR393b validated using RNA ligase-mediated rapid amplification of 5' cDNA ends (RLM-5'RACE). Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) confirmed the expression patterns of five miRNAs and their target genes, consistent with sequencing data. Network analysis revealed the involvement of the auxin signaling pathway and a complex miRNA regulatory network in fruit enlargement. Key miRNA-target interactions, such as ppe-miR160a-ARFs, ppe-miR172a/c/d-AP2s, ppe-miR166a -ATHBs, and ppe-miR319c/e-TCPs were implicated in cell proliferation and differentiation, with novel findings including ppe-miR171b/f/h-SCL6s in cell division. In summary, peach miRNAs primarily regulate early fruit growth and development by modulating auxin signaling and mediating cell division and differentiation. These findings provide critical insights into miRNA-mediated mechanisms underlying peach fruit development and establish a foundation for future research on drupe fruit crops.
  • 加载中
  • Supplementary Table S1 Statistical analysis of the sequencing reads from peach sRNA and degradome libraries; DPA, days post-anthesis.
    Supplementary Table S2 Characteristics of novel peach miRNAs from DPA20, DAP50 and DPA75 libraries.
    Supplementary Table S3 Differentially expressed peach miRNAs in DPA50 vs. DPA20 and DPA75 vs. DPA50 libraries; |log2(fold change)| > 1 and q-value < 0.01.
    Supplementary Table S4 Summary of the ppe-miRNAs targets identified by degradome sequencing at DPA 20, DPA50 and DPA75.
    Supplementary Table S5 Enrichment of differentially expressed target genes in DPA50 vs. DPA20 and DPA75 vs. DPA50 libraries; Threshold p-value ≤ 0.05.
    Supplementary Table S6 Details of the ppe-miRNAs targets identified by degradome sequencing at DPA 20 and DPA50.
    Supplementary Table S7 Details of the ppe-miRNAs targets identified by degradome sequencing at DPA 50 and DPA75.
    Supplementary Table S8 Primers used for qRT-PCR analyses and RLM-5'RACE.
    Supplementary Fig. S1 Changes in the longitudinal and transverse diameters of 'Baifeng' peach during different developmental stages.
    Supplementary Fig. S2 Proportion of the first nucleotide bias within novel miRNAs of the same length in the three libraries of peach sRNAs
    Supplementary Fig. S3 Expression analysis of the known and novel peach miRNAs identified by sequencing analyses; miRNAs were grouped into four classes (I–IV) based on their accumulation patterns. DPA20, DPA50 and DPA75 indicate 20, 50 and 75 days post anthesis, respectively.
    Supplementary Fig. S4 Significantly enriched GO terms for the target genes of peach miRNAs in DPA50 vs. DPA20 (a) and DPA75 vs. DPA50 (b) libraries; enriched factors were calculated according to the numbers of differentially expressed genes which were mapped to GO term divided by the numbers of all genes in that GO term; the top 20 enriched GO terms are listed.
    Supplementary Fig. S5 Target plot (t-plots) of peach miRNA targets and validation of target genes by RLM-5'RACE. The red line represents the sliced target transcripts. miRNA: mRNA alignments along with the miRNA-directed cleavage positions are shown below. Watson-Crick pairing (vertical dashes) and G:U wobble pairing (circles) are indicated and the numbers show the frequency of clones sequenced.
  • [1] Zhan J, Meyers BC. 2023. Plant small RNAs: their biogenesis, regulatory roles, and functions. Annual Review of Plant Biology 74:21−51 doi: 10.1146/annurev-arplant-070122-035226

    CrossRef   Google Scholar

    [2] Vaucheret H, Voinnet O. 2024. The plant siRNA landscape. The Plant Cell 36(2):246−75 doi: 10.1093/plcell/koad253

    CrossRef   Google Scholar

    [3] Rogers K, Chen X. 2013. Biogenesis, turnover, and mode of action of plant microRNAs. The Plant Cell 25(7):2383−99 doi: 10.1105/tpc.113.113159

    CrossRef   Google Scholar

    [4] Navarro L, Dunoyer P, Jay F, Arnold B, Dharmasiri N, et al. 2006. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312:436−39 doi: 10.1126/science.1126088

    CrossRef   Google Scholar

    [5] Krol J, Loedige I, Filipowicz W. 2010. The widespread regulation of microRNA biogenesis, function and decay. Nature Reviews Genetics 11(9):597−610 doi: 10.1038/nrg2843

    CrossRef   Google Scholar

    [6] Xie F, Jones DC, Wang Q, Sun R, Zhang B. 2015. Small RNA sequencing identifies miRNA roles in ovule and fibre development. Plant Biotechnology Journal 13(3):355−69 doi: 10.1111/pbi.12296

    CrossRef   Google Scholar

    [7] Farooq M, Mansoor S, Guo H, Imran A, Chee, et al. 2017. Identification and characterization of miRNA transcriptome in asiatic cotton (Gossypium arboreum) using high throughput sequencing. Frontiers in Plant Science 8:969 doi: 10.3389/fpls.2017.00969

    CrossRef   Google Scholar

    [8] Liu M, Yu H, Zhao G, Huang Q, Lu Y, et al. 2017. Profiling of drought-responsive microRNA and mRNA in tomato using high-throughput sequencing. BMC Genomics 18(1):481 doi: 10.1186/s12864-017-3869-1

    CrossRef   Google Scholar

    [9] Liu M, Yu H, Zhao G, Huang Q, Lu Y, et al. 2018. Identification of drought-responsive microRNAs in tomato using high-throughput sequencing. Functional & Integrative Genomics 18(1):67−78 doi: 10.1007/s10142-017-0575-7

    CrossRef   Google Scholar

    [10] Ferigolo LF, Vicente MH, Correa JPO, Barrera-Rojas CH, Silva EM, et al. 2023. Gibberellin and miRNA156-targeted SlSBP genes synergistically regulate tomato floral meristem determinacy and ovary patterning. Development 150(21):dev201961 doi: 10.1242/dev.201961

    CrossRef   Google Scholar

    [11] Wang C, Jogaiah S, Zhang W, Abdelrahman M, Fang JG. 2018. Spatio-temporal expression of miRNA159 family members and their GAMYB target gene during the modulation of gibberellin-induced grapevine parthenocarpy. Journal of Experimental Botany 69(15):3639−50 doi: 10.1093/jxb/ery172

    CrossRef   Google Scholar

    [12] Li D, Mou W, Luo Z, Li L, Limwachiranon J, et al. 2016. Developmental and stress regulation on expression of a novel miRNA, Fan-miR73, and its target ABI5 in strawberry. Scientific Reports 6:28385 doi: 10.1038/srep28385

    CrossRef   Google Scholar

    [13] Meyers BC, Axtell MJ. 2019. MicroRNAs in plants: key findings from the early years. The Plant Cell 31(6):1206−07 doi: 10.1105/tpc.19.00310

    CrossRef   Google Scholar

    [14] Azad MF, Dawar P, Esim N, Rock CD. 2023. Role of miRNAs in sucrose stress response, reactive oxygen species, and anthocyanin biosynthesis in Arabidopsis thaliana. Frontiers in Plant Science 14:1278320 doi: 10.3389/fpls.2023.1278320

    CrossRef   Google Scholar

    [15] Qu D, Yan F, Meng R, Jiang X, Yang H, et al. 2016. Identification of MicroRNAs and their targets associated with fruit-bagging and subsequent sunlight re-exposure in the "Granny Smith" apple exocarp using high-throughput sequencing. Frontiers in Plant Science 7:27 doi: 10.3389/fpls.2016.00027

    CrossRef   Google Scholar

    [16] Zhao F, Wang C, Han J, Zhu X, Li X, et al. 2017. Characterization of miRNAs responsive to exogenous ethylene in grapevine berries at whole genome level. Functional & Integrative Genomics 17(2-3):213−35 doi: 10.1007/s10142-016-0514-z

    CrossRef   Google Scholar

    [17] Guo DL, Li Q, Lv WQ, Zhang GH, Yu YH. 2018. MicroRNA profiling analysis of developing berries for 'Kyoho' and its early-ripening mutant during berry ripening. BMC Plant Biology 18(1):285 doi: 10.1186/s12870-018-1516-x

    CrossRef   Google Scholar

    [18] Zhu H, Xia R, Zhao B, An Y, Dardick CD, et al. 2012. Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs. BMC Plant Biology 12:149 doi: 10.1186/1471-2229-12-149

    CrossRef   Google Scholar

    [19] Zhang Y, Bai Y, Han J, Chen Ming, Kayesh E, et al. 2013. Bioinformatics prediction of miRNAs in the Prunus persica genome with validation of their precise sequences by miR-RACE. Journal of Plant Physiology 170(1):80−92 doi: 10.1016/j.jplph.2012.08.021

    CrossRef   Google Scholar

    [20] Saminathan T, Bodunrin A, Singh NV, Devarajan R, Nimmakayala P, et al. 2016. Genome-wide identification of microRNAs in pomegranate (Punica granatum L.) by high-throughput sequencing BMC Plant Biology 16(1):122 doi: 10.1186/s12870-016-0807-3

    CrossRef   Google Scholar

    [21] Xin C, Liu W, Lin Q, Zhang X, Cui P, et al. 2015. Profiling microRNA expression during multi-staged date palm (Phoenix dactylifera L.) fruit development. Genomics 105(4):242−51 doi: 10.1016/j.ygeno.2015.01.004

    CrossRef   Google Scholar

    [22] Wu J, Zheng S, Feng G, Yi H. 2016. Comparative analysis of miRNAs and their target transcripts between a spontaneous late-ripening sweet orange mutant and its wild-type using small RNA and degradome sequencing. Frontiers in Plant Science 7:1416 doi: 10.3389/fpls.2016.01416

    CrossRef   Google Scholar

    [23] Hou Y, Zhai L, Li X, Xue Y, Wang J, et al. 2017. Comparative analysis of fruit ripening-related miRNAs and their targets in blueberry using small RNA and degradome sequencing. International Journal of Molecular Sciences 18(12):2767 doi: 10.3390/ijms18122767

    CrossRef   Google Scholar

    [24] Lowenstein DM, Minor ES. 2016. Diversity in flowering plants and their characteristics: integrating humans as a driver of urban floral resources. Urban Ecosystems 19:1735−48 doi: 10.1007/s11252-016-0563-z

    CrossRef   Google Scholar

    [25] Tani E, Tsaballa A, Stedel C, Kalloniati C, Papaefthimiou D, et al. 2011. The study of a SPATULA-like bHLH transcription factor expressed during peach (Prunus persica) fruit development. Plant Physiology and Biochemistry 49(6):654−63 doi: 10.1016/j.plaphy.2011.01.020

    CrossRef   Google Scholar

    [26] Jung S, Staton M, Lee T, Blenda A, Svancara R, et al. 2008. GDR (Genome Database for Rosaceae): integrated web-database for Rosaceae genomics and genetics data. Nucleic Acids Research 36:D1034−D1040 doi: 10.1093/nar/gkm803

    CrossRef   Google Scholar

    [27] Veerappan K, Natarajan S, Chung H, Park J. 2021. Molecular insights of fruit quality traits in peaches, Prunus persica. Plants 10(10):2191 doi: 10.3390/plants10102191

    CrossRef   Google Scholar

    [28] Esmaeili F, Shiran B, Fallahi H, Mirakhorli N, Budak H, et al. 2017. In silico search and biological validation of microRNAs related to drought response in peach and almond. Functional & Integrative Genomics 17:189−201 doi: 10.1007/s10142-016-0488-x

    CrossRef   Google Scholar

    [29] Gao Z, Luo X, Shi T, Cai B, Zhang Z, et al. 2012. Identification and validation of potential conserved microRNAs and their targets in peach (Prunus persica). Molecules and Cells 34(3):239−50 doi: 10.1007/s10059-012-0004-7

    CrossRef   Google Scholar

    [30] Luo X, Gao Z, Shi T, Cheng Z, Zhang Z, et al. 2013. Identification of miRNAs and their target genes in peach (Prunus persica L.) using high-throughput sequencing and degradome analysis. PLoS One 8:e79090 doi: 10.1371/journal.pone.0079090

    CrossRef   Google Scholar

    [31] Quan W, Liu B, Wang Y. 2021. Fast and SNP-aware short read alignment with SALT. BMC Bioinformatics 22(Suppl 9):172 doi: 10.1186/s12859-021-04088-6

    CrossRef   Google Scholar

    [32] Wen M, Shen Y, Shi S, Tang T. 2012. miREvo: an integrative microRNA evolutionary analysis platform for next-generation sequencing experiments. BMC Bioinformatics 13:140 doi: 10.1186/1471-2105-13-140

    CrossRef   Google Scholar

    [33] Friedländer MR, Mackowiak SD, Li N, Chen W, Rajewsky N. 2012. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Research 40(1):37−52 doi: 10.1093/nar/gkr688

    CrossRef   Google Scholar

    [34] Tang Y, Ghosal S, Roy A. 2007. Nonparametric bayesian estimation of positive false discovery rates. Biometrics 63(4):1126−34 doi: 10.1111/j.1541-0420.2007.00819.x

    CrossRef   Google Scholar

    [35] Addo-Quaye C, Miller W, Axtell MJ. 2009. CleaveLand: a pipeline for using degradome data to find cleaved small RNA targets. Bioinformatics 25(1):130−31 doi: 10.1093/bioinformatics/btn604

    CrossRef   Google Scholar

    [36] Kohl M, Wiese S, Warscheid B. 2011. Cytoscape: software for visualization and analysis of biological networks. In Data Mining in Proteomics, eds Hamacher M, Eisenacher M, Stephan C. US: Humana Press. Volume 696. pp. 291−303. doi: 10.1007/978-1-60761-987-1_18
    [37] Shangguan L, Song C, Han J, Leng X, Kibet KN, et al. 2014. Characterization of regulatory mechanism of Poncirus trifoliata microRNAs on their target genes with an integrated strategy of newly developed PPM-RACE and RLM-RACE. Gene 535(1):42−52 doi: 10.1016/j.gene.2013.10.069

    CrossRef   Google Scholar

    [38] Tiwari B, Habermann K, Arif MA, Top O, Frank W. 2021. Identification of small RNAs during high light acclimation in Arabidopsis thaliana. Frontiers in Plant Science 12:656657 doi: 10.3389/fpls.2021.656657

    CrossRef   Google Scholar

    [39] Varkonyi-Gasic E. 2017. Stem-loop qRT-PCR for the detection of plant microRNAs. In Plant Epigenetics, ed. Kovalchuk I. Boston, MA: Humana Press.Volume 1456. pp. 163−75. doi: 10.1007/978-1-4899-7708-3_13
    [40] Pasquinelli AE. 2012. MicroRNAs and their targets: recognition, regulation and an emerging reciprocal relationship. Nature Review Genetics 13(4):271−82 doi: 10.1038/nrg3162

    CrossRef   Google Scholar

    [41] Dai X, Lu Q, Wang J, Wang L, Xiang F, et al. 2021. MiR160 and its target genes ARF10, ARF16 and ARF17 modulate hypocotyl elongation in a light, BRZ, or PAC-dependent manner in Arabidopsis: miR160 promotes hypocotyl elongation. Plant Science 303:110686 doi: 10.1016/j.plantsci.2020.110686

    CrossRef   Google Scholar

    [42] de Sousa Cardoso TC, Alves TC, Caneschi CM, dos Reis Gomes Santana D, Fernandes-Brum CN, et al. 2018. New insights into tomato microRNAs. Science Reports 8(1):16069 doi: 10.1038/s41598-018-34202-3

    CrossRef   Google Scholar

    [43] Li BJ, Bao RX, Shi YN, Grierson D, Chen KS. 2024. Auxin response factors: important keys for understanding regulatory mechanisms of fleshy fruit development and ripening. Horticulture Research 11(10):uhae209 doi: 10.1093/hr/uhae209

    CrossRef   Google Scholar

    [44] Shi M, Hu X, Wei Y, Hou X, Yuan X, et al. 2017. Genome-wide profiling of small RNAs and degradome revealed conserved regulations of miRNAs on auxin-responsive genes during fruit enlargement in peaches. International Journal of Molecular Science 18(12):2599 doi: 10.3390/ijms18122599

    CrossRef   Google Scholar

    [45] Zimmerman K, Pegler JL, Oultram JMJ, Collings DA, Wang MB, et al. 2024. Molecular manipulation of the miR160/AUXIN RESPONSE FACTOR expression module impacts root development in Arabidopsis thaliana. Genes 15(8):1042 doi: 10.3390/genes15081042

    CrossRef   Google Scholar

    [46] Wang Y, Li W, Chang H, Zhou J, Luo Y, et al. 2020. SRNAome and transcriptome analysis provide insight into strawberry fruit ripening. Genomics 112(3):2369−78 doi: 10.1016/j.ygeno.2020.01.008

    CrossRef   Google Scholar

    [47] Tang J, Chu C. 2017. MicroRNAs in crop improvement: fine-tuners for complex traits. Nature Plants 3:17077 doi: 10.1038/nplants.2017.77

    CrossRef   Google Scholar

    [48] Samad AFA, Sajad M, Nazaruddin N, Fauzi IA, Murad AM, et al. 2017. MicroRNA and transcription factor: key players in plant regulatory network. Frontiers in Plant Science 8:565 doi: 10.3389/fpls.2017.00565

    CrossRef   Google Scholar

    [49] Zhang H, Yin L, Wang H, Wang G, Ma X, et al. 2017. Genome-wide identification of Hami melon miRNAs with putative roles during fruit development. PLoS One 12(7):e0180600 doi: 10.1371/journal.pone.0180600

    CrossRef   Google Scholar

    [50] Cui J, You C, Chen X. 2017. The evolution of microRNAs in plants. Current Opinion in Plant Biology 35:61−67 doi: 10.1016/j.pbi.2016.11.006

    CrossRef   Google Scholar

    [51] Sun YH, Lu S, Shi R, Chiang VL. 2011. Computational prediction of plant miRNA targets. In RNAi and Plant Gene Function Analysis, eds Kodama H, Komamine A. US: Humana Press. Volume 744. pp. 175−86. doi: 10.1007/978-1-61779-123-9_12
    [52] Yadav A, Kumar S, Verma R, Lata C, Sanyal I, et al. 2021. microRNA 166: an evolutionarily conserved stress biomarker in land plants targeting HD-ZIP family. Physiology and Molecular Biology of Plants 27:2471−85 doi: 10.1007/s12298-021-01096-x

    CrossRef   Google Scholar

    [53] Jia X, Ding N, Fan W, Yan J, Gu Y, et al. 2015. Functional plasticity of miR165/166 in plant development revealed by small tandem target mimic. Plant Science 233:11−21 doi: 10.1016/j.plantsci.2014.12.020

    CrossRef   Google Scholar

    [54] Ma L, Zhao Y, Chen M, Li Y, Shen Z, et al. 2023. The microRNA ppe-miR393 mediates auxin-induced peach fruit softening by promoting ethylene production. Plant Physiology 192(2):1638−55 doi: 10.1093/plphys/kiad182

    CrossRef   Google Scholar

    [55] Gaddam SR, Sharma A, Bhatia C, Trivedi PK. 2024. A network comprising ELONGATED HYPOCOTYL 5, microRNA397b, and auxin-associated factors regulates root hair growth in Arabidopsis. Plant Physiology 196(2):1460−74 doi: 10.1093/plphys/kiae301

    CrossRef   Google Scholar

    [56] Jiang J, Zhu H, Li N, Batley J, Wang Y. 2022. The miR393-target module regulates plant development and responses to biotic and abiotic stresses. International Journal of Molecular Sciences 23(16):9477 doi: 10.3390/ijms23169477

    CrossRef   Google Scholar

    [57] Wang J, Li R, Chen Y, Wang X, Shi Q, et al. 2023. Expressing a Short Tandem Target Mimic (STTM) of miR164b/e-3p enhances poplar leaf serration by co-regulating the miR164-NAC module. Plant Physiology and Biochemistry 201:107790 doi: 10.1016/j.plaphy.2023.107790

    CrossRef   Google Scholar

    [58] Karidas P, Challa KR, Nath U. 2015. The tarani mutation alters surface curvature in Arabidopsis leaves by perturbing the patterns of surface expansion and cell division. Journal of Experimental Botany 66(7):2107−22 doi: 10.1093/jxb/erv015

    CrossRef   Google Scholar

    [59] Liu X, Guo LX, Jin LF, Liu YZ, Liu T, et al. 2016. Identification and transcript profiles of citrus growth-regulating factor genes involved in the regulation of leaf and fruit development. Molecular Biology Reports 43(10):1059−67 doi: 10.1007/s11033-016-4048-1

    CrossRef   Google Scholar

    [60] Chung MY, Nath UK, Vrebalov J, Gapper N, Lee JM, et al. 2020. Ectopic expression of miRNA172 in tomato (Solanum lycopersicum) reveals novel function in fruit development through regulation of an AP2 transcription factor. BMC Plant Biology 20(1):283 doi: 10.1186/s12870-020-02489-y

    CrossRef   Google Scholar

  • Cite this article

    Zhang Y, Zhu X, Wang C, Ge M. 2025. Characterisation of early fruit development-specific miRNAs and their targets in peach using small RNA and degradome sequencing. Fruit Research 5: e021 doi: 10.48130/frures-0025-0010
    Zhang Y, Zhu X, Wang C, Ge M. 2025. Characterisation of early fruit development-specific miRNAs and their targets in peach using small RNA and degradome sequencing. Fruit Research 5: e021 doi: 10.48130/frures-0025-0010

Figures(7)  /  Tables(2)

Article Metrics

Article views(4856) PDF downloads(1320)

Other Articles By Authors

ARTICLE   Open Access    

Characterisation of early fruit development-specific miRNAs and their targets in peach using small RNA and degradome sequencing

Fruit Research  5 Article number: e021  (2025)  |  Cite this article

Abstract: Peach (Prunus persica L.) is a key drupe fruit crop characterized by a double-sigmoid growth pattern during fruit development. MicroRNAs (miRNAs) play pivotal regulatory roles in this process; however, their functions in early peach fruit development remain poorly understood. To address this, we conducted high-throughput small RNA (sRNA) sequencing at three critical developmental stages: 20, 50, and 75 d post-anthesis (DPA20, DPA50, DPA75), representing exponential growth, lag phase, and rapid regrowth, respectively. We identified 124 known miRNAs from 70 families and 86 novel miRNAs, with 97 and 79 miRNAs differentially expressed between DPA50 vs DPA20 and DPA75 vs DPA50, respectively. Degradome sequencing revealed 216 target genes for 74 known and eight novel miRNAs, with targets of ppe-miR160a and ppe-miR393b validated using RNA ligase-mediated rapid amplification of 5' cDNA ends (RLM-5'RACE). Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) confirmed the expression patterns of five miRNAs and their target genes, consistent with sequencing data. Network analysis revealed the involvement of the auxin signaling pathway and a complex miRNA regulatory network in fruit enlargement. Key miRNA-target interactions, such as ppe-miR160a-ARFs, ppe-miR172a/c/d-AP2s, ppe-miR166a -ATHBs, and ppe-miR319c/e-TCPs were implicated in cell proliferation and differentiation, with novel findings including ppe-miR171b/f/h-SCL6s in cell division. In summary, peach miRNAs primarily regulate early fruit growth and development by modulating auxin signaling and mediating cell division and differentiation. These findings provide critical insights into miRNA-mediated mechanisms underlying peach fruit development and establish a foundation for future research on drupe fruit crops.

    • MicroRNAs (miRNAs) are small, endogenous, non-coding RNA molecules, typically 20−22 nucleotides (nt) in length, that play critical regulatory roles in various biological processes, including development, abiotic stress responses, signal transduction, and pathogen resistance[15]. Extensive studies have demonstrated that miRNAs are ubiquitous in plants and exhibit high conservation across species. To date, a large number of miRNAs have been identified and cataloged in miRBase (version 22.0), highlighting their essential functions in numerous metabolic processes, particularly fruit development[69]. For instance, overexpression of miR156b has been linked to abnormal fruit morphology in tomato plants[10]. Additionally, miR156/157 and miR172 have been shown to regulate tomato ripening by targeting key regulators such as CNR and AP2a. In strawberries, miR159a targets FaGAMYB, which is involved in the transition from receptacle development to ripening[11]. Similarly, miR73 modulates ABI5, a regulator of strawberry ripening through the ABA signaling pathway[12].

      MiRNAs have been identified by predictive bioinformatics analyses and Sanger sequencing[13,14]. Recently, rapid developments in high-throughput sequencing have facilitated the application of transcriptome profiling in identifications in various fruit-producing species such as apple[15], grape[16,17], peach[18,19], pomegranate[20], date palm[21], sweet orange[22], and blue berry[23]. Similarly, degradome sequencing has revealed miRNA-mRNA target pairs which are prevalent during fruit development[15,22]. Moreover, the combination analyses of miRNAome and degradome have verified various roles of miRNAs during fruit development.

      Peach (Prunus persica L.) is a highly valued deciduous fruit crop, prized for its delicious and nutritious fruit, and is widely cultivated in temperate regions worldwide. As a member of the Rosaceae family, which comprises over 3,000 species across approximately 110 genera[24]. Given their small genome size of approximately 300 Mb and relatively short reproductive time, peaches have been considered a plant genome model for Rosaceae[25,26]. The draft genome of peach (peach v2.0, derived from the 'Lovell' haploid) was sequenced by the International Peach Genome Initiative and is publicly accessible in the Genome Database for Rosaceae (www.rosaceae.org/peach/genome). Peach fruit development follows a typical double-sigmoid growth pattern[27], characterized by three distinct stages: an initial phase of exponential fruit size increase (FWI), a central lag phase with reduced growth rates (FWII), and a final phase of rapid regrowth (FWIII). Throughout these stages, the external appearance and internal physiological processes of the fruit undergo significant changes, with variations in fruit size, color, sugar content, organic acid levels, and hormone dynamics reflecting the expression profiles of specific genes and their regulators. Although miRNAs have been identified in various peach organs, including leaves, winter buds, roots, stems, flowers, and fruits[18,2830], comprehensive analyses of miRNAs and their target genes across the three key stages of peach fruit development remain limited. Previous studies relied on a single mixed library to identify peach fruit miRNAs and their targets[18], underscoring the need for more detailed investigations[18].

      In contrast to previous approaches, we utilized three sRNA libraries and their corresponding degradome libraries, each representing a distinct developmental stage, to identify and characterize miRNAs and their targets at each phase of peach fruit development. Furthermore, we conducted a comprehensive analysis of differentially expressed miRNAs and their targets across these stages. Our findings provide valuable insights into the regulatory roles of miRNAs in controlling peach fruit development, shedding light on the molecular mechanisms underlying this process.

    • After flowering, fruit samples were collected from 10-year-old 'Baifeng' peach trees cultivated under standard field conditions in Suzhou, China. Sampling was performed at 10, 20, 30, 40, 50, 63, 75, 87, and 95 days post-anthesis (DPA). Nine 'Baifeng' trees were evenly divided into three groups, with each group serving as a technical replicate containing three biological replicates. On each sampling date, single-bearing shoots were selected from each tree. The longitudinal and transverse diameters of the fruits were measured using vernier calipers, after which the pulp was separated, immediately snap-frozen in liquid nitrogen, and stored at −80 °C until further use.

    • After identifying three key sampling points on the double-sigmoid growth curve of 'Baifeng' peaches, we selected DPA20, DPA50, and DPA75 as representative stages of FWI, FWII, and FWIII, respectively, for sRNA and degradome sequencing. Total RNA was extracted from fruit pulp samples at DPA20, DPA50, and DPA75 using TRIzol reagent (Invitrogen, CA, USA). RNA quality was assessed using an Agilent Bioanalyzer, and sample concentrations were determined with a Nanodrop Spectrophotometer. Subsequently, three sRNA and degradome libraries were constructed and subjected to single-end sequencing (50 bp) on an Illumina HiSeq 2500 platform (Illumina Inc., San Diego, CA, USA) at LC-BIO (Hangzhou, China). The raw sequencing data for small RNA and degradome libraries have been deposited in the NCBI Short Read Archive under the following accession numbers: DPA20-miRNAs (SRX4011348), DPA50-miRNAs (SRX4011349), DPA75-miRNAs (SRX4011350), DPA20-degradome (SRX4011351), DPA50-degradome (SRX4011352), and DPA75-degradome (SRX4011353).

    • Clean data were generated using the methodology detailed by Liu et al.[9]. sRNA within the size range of 18–30 nucleotides (nt) were extracted from the clean reads and subsequently aligned to the peach reference genome (www.rosaceae.org/organism/Prunus/persica) using Bowtie[31]. To exclude non-miRNA sequences, the Rfam (www.sanger.ac.uk/Software/Rfam) and GenBank (www.ncbi.nlm.nih.gov/GenBank) databases were used to filter out coding RNAs, rRNAs, tRNAs, small nuclear RNAs (snRNAs), and small nucleolar RNAs (snoRNAs). To identify conserved miRNAs, the small RNA reads were further mapped to the annotated miRNAs in miRBase 22. After removing the reads classified as conserved miRNAs, miREvo[32], and mirdeep2[33] with default parameters were integrated to predict novel miRNAs in the peach genome.

    • Differentially expressed miRNAs were identified by calculating the transcripts per million (TPM) values for each miRNA as follows: (miRNA counts / total mapped reads) × 1,000,000. Differential expression analyses of DPA50 vs DPA20 and DPA75 vs DPA50 were then performed using the DEGseq (2010) R package. P-values were adjusted as described previously using q-value < 0.01 and |log2(foldchange)| > 1 as the thresholds for significant differential expression[34].

    • Raw sequencing reads were processed using the Illumina software to remove adaptors and low-quality reads. The extracted sequencing reads were subsequently analyzed using the Cleave Land pipeline to identify potentially miRNA-mediated cleavage targets[35]. Degradome reads were aligned to the mRNA sequences obtained from the Genome Database for Rosaceae (GDR) (www.rosaceae.org/species/prunus_persica/genome_v1.0), with only perfectly matching alignment(s) for degradation analysis. All reads were reverse-complemented and mapped to the miRNAs identified in this study, allowing a maximum of four mismatches. Alignments were retained and scored if the degradome sequence position corresponded to the 10th or 11th nucleotide of the miRNA. Targets were selected and categorized into classes 0, 1, 2, 3, or 4 as previously described[22]. In addition, to analyse miRNA targets and RNA degradation patterns, t-plots were built according to the distributions of signatures (and abundances) of transcripts. All identified targets were subjected to BlastX analysis to assess sequence similarities, followed by gene ontology (GO) analysis (www.geneontology.org) to elucidate miRNA regulatory networks. Network visualization and analysis were performed using the Cytoscape platform[36].

    • To validate the sequencing results, the expression levels of five miRNAs and nine target genes were confirmed using qRT-PCR. cDNA synthesis was performed following the method described by Zhang et al.[19]. The precise sequence of ppe-miRNA was used as the forward primer and the miR-RACE 3'-primer was used as the reverse primer (Supplementary Table S1)[37]. Gene-specific primers overlapping with predicted complementary sites were designed for target gene amplification (Supplementary Table S1). qRT-PCR was conducted on a Rotor-Gene 3000 instrument (Corbett Robotics, Australia) using Rotor-Gene software version 6.1[38] and SYBR Green reaction mix (Toyobo, Osaka, Japan). U6 and RPII were used as internal controls for miRNA and mRNA normalization, respectively[39]. Each sample was analyzed with three biological replicates and three technical replicates to ensure reproducibility and reliability.

    • RLM-5'RACE was performed using the SMARTer™ RACE cDNA Amplification Kit (Clontech Laboratories Inc., PaloAlto, CA, USA) following the manufacturer's instructions. Briefly, the RNA adapter was ligated to the purified RNAs as described by Zhang et al.[19]. The ligation products were then reverse transcribed, followed by PCR amplification using universal primers and gene-specific primers (Supplementary Table S1). The RACE products were gel-purified, cloned, and sequenced for further analysis.

    • Growing peaches display typical double-sigmoid growth patterns, but the key transition points of peach vary across peach varieties. Therefore, to elucidate the regulatory mechanisms underlying peach development, it is essential to conduct analyses at multiple time points. To address this, we collected fruit samples from 10-year-old 'Baifeng' peach trees at various stages post-flowering (Fig. 1), and measured the longitudinal and transverse diameters of the fruits.

      Figure 1. 

      Fruit profiles at defined peach developmental stages (scale bar = 1 cm).

      Our observations confirmed the double-sigmoid growth pattern in 'Baifeng' peach fruits (Supplementary Fig. S1). From 10 to 40 d post-anthesis (DPA10 to DPA40), the fruits underwent the first exponential growth phase (FWI). This was followed by a slow growth phase (FWII) from DPA40 to DPA63, characterized by hardening of the fruit core. Subsequently, from DPA63 to DPA87, the fruits entered a second exponential growth phase (FWIII). Based on these findings, we selected DPA20, DPA50, and DPA75 as representative time points for FWI, FWII, and FWIII, respectively.

    • To identify miRNAs involved in the development of peach fruit, three sRNA libraries representing DPA20, DPA50, and DPA75 were constructed and sequenced. In total of 12,017,340, 12,258,319, and 10,356,759 raw reads were generated from the DPA20, DPA50, and DPA75 libraries, respectively (Supplementary Table S2). After filtering out low-quality reads, adapters, junk reads, and redundant repeats, 11,429,372, 11,828,096, and 9,995,951 clean reads were obtained. Small RNAs ranging from 18 to 30 nucleotides (nt) accounted for 85.05% (DPA20), 89.79% (DPA50), and 93.64% (DPA75) of the clean reads (Supplementary Table S2) and were retained for further analysis. The length distribution of sRNAs was analyzed across the three libraries (Fig. 2). sRNAs with 21 and 24 nt were the most abundant, collectively representing an average of 75.5% of all sRNAs. However, the length distribution varied slightly among libraries: 21-nt sRNAs constituted 29.4% of the reads in the DPA75 library, while 24-nt sRNAs were predominant in the DPA20 and DPA50 libraries, accounting for 18.3% and 22.8% of the reads, respectively.

      Figure 2. 

      Length distributions of sRNAs of peaches in the libraries at 20 d post anthesis (DPA20), DPA50, and DPA75.

      To identify miRNA targets during peach fruit development, transcriptome-wide degradome sequencing was performed to detect miRNA-mediated cleavage sites, which are characterized by endonucleolytic cleavage driven by extensive, often perfect, mRNA complementarity[40]. These analyses identified 26,557,773, 24,876,000, and 31,586,572 raw reads from the DPA20, DPA50, and DPA75 libraries, respectively (Supplementary Table S2). Approximately 7.27, 6.88, and 7.69 million unique sequences were successfully mapped to the peach genome sequences, accounting for 99.29% of all unique reads (Supplementary Table S2). Among these, over 60% of the reads were mapped to peach cDNA sequences, and all mapped sequences were subsequently used to identify miRNA targets.

    • To identify fruit-specific miRNAs, mRNA sequences from DPA20, DPA50, and DPA75 fruits were aligned with known miRNAs from the publicly available database miRbase (version 22). Following a series of screening, 124 known miRNAs belonging to 75 families and 86 novel miRNAs were identified in the three peach fruit samples (Table 1; Supplementary Table S3). We further analyzed the distribution of these miRNAs among the three stages. Among the known miRNAs, 85 (68.5%) were detected in all stages, while seven miRNAs (ppe-miR5225-3p, ppe-miR5225-5p, ppe-miR6267a, ppe-miR6280, ppe-miR6282, ppe-miR6283, and ppe-miR8127-5p) were exclusively detected in DPA20 fruits, four (ppe-miR169f, ppe-miR6266a, ppe-miR6285, and ppe-miR8130-5p) were specific to DPA50 and 13 (ppe-miR156f, ppe-miR2111a, ppe-miR319b, ppe-miR6260, ppe-miR6261, ppe-miR6263, ppe-miR6271, ppe-miR6287, ppe-miR6288b-3p, ppe-miR6290, ppe-miR6292, ppe-miR6297b, and ppe-miR8128-5p) were unique to DPA75 (Fig. 3 & Table 1).

      Table 1.  Characteristics of know miRNAs identified from DPA20, DAP50, and DPA75 libraries in peach fruit.

      miRNA ID miRNA sequences (5'-3') LT1 TPM2
      DPA20 DPA50 DPA75
      ppe-miR1511-5p CGUGGUAUCAGAGUCAUGUUA 21 154,692.1383 14,578.83618 17,587.11608
      ppe-miR1511-3p ACCUGGCUCUGAUACCAUAAC 21 21.90796464 20.71184303 44.79237715
      ppe-miR156a UGACAGAAGAAAGAGAGCAC 20 0 4.602631785 26.46822286
      ppe-miR156c UGACAGAAGAGAGUGAGCAC 20 0 16.10921125 22.39618858
      ppe-miR156f UGACAGAAGAUAGAGAGCAC 20 0 0 10.18008572
      ppe-miR159a UUUGGAUUGAAGGGAGCUCUA 21 217,885.6623 131,131.2809 98,590.05813
      ppe-miR159b CUUGGAUUGAAGGGAGCUCCA 21 381,669.606 15,059.8112 12,138.73421
      ppe-miR160a UGCCUGGCUCCCUGUAUGCCA 21 1,084.44425 333.6908044 177.1334915
      ppe-miR162 UCGAUAAACCUCUGCAUCCAG 21 9,792.860194 7,748.53061 4,200.303367
      ppe-miR164a UGGAGAAGCAGGGCACGUGCA 21 613.4230099 2,285.206681 804.2267716
      ppe-miR164d UGGAGAAGCAGGGCACAUGCU 21 10.95398232 2.301315892 0
      ppe-miR166a UCGGACCAGGCUUCAUUCCCC 21 18,358.87437 7,847.487193 3,273.915566
      ppe-miR167a UGAAGCUGCCAGCAUGAUCUA 21 1,424.017702 352.1013315 677.9937087
      ppe-miR167c UGAAGCUGCCAGCAUGAUCUGA 22 3,768.169918 844.5829325 659.6695544
      ppe-miR167d UGAAGCUGCCAGCAUGAUCUUA 22 1,577.373454 342.896068 494.7521658
      ppe-miR168 UCGCUUGGUGCAGGUCGGGAA 21 492.9292044 92.0526357 89.5847543
      ppe-miR169f UAGCCAAGGAUGACUUGCCUGC 22 0 2.301315892 0
      ppe-miR171b UUGAGCCGCGCCAAUAUCACU 21 120.4938055 23.01315892 30.54025715
      ppe-miR171d-5p UGUGAUAUUGGUUCGGUUCAUA 22 10.95398232 11.50657946 22.39618858
      ppe-miR171d-3p CGAGCCGAAUCAAUAUCACUC 21 10.95398232 4.602631785 16.28813715
      ppe-miR171e UUAUUGAACCGGACCAAUAUC 21 10.95398232 2.301315892 0
      ppe-miR171f UGAUUGAGCCGUGCCAAUAUC 21 295.7575226 133.4763218 67.18856573
      ppe-miR171h UUGAGCCGCGUCAAUAUCUCC 21 635.3309746 211.7210621 24.43220572
      ppe-miR172a-3p AGAAUCUUGAUGAUGCUGCAU 21 120.4938055 20.71184303 12.21610286
      ppe-miR172c GGAAUCUUGAUGAUGCUGCAU 21 32.86194696 4.602631785 16.28813715
      ppe-miR172d GGAAUCUUGAUGAUGCUGCAG 21 65.72389392 2.301315892 4.072034287
      ppe-miR2111a UAAUCUGCAUCCUGAGGUUUA 21 0 0 2.036017143
      ppe-miR319a UUGGACUGAAGGGAGCUCCC 20 164.3097348 29.9171066 171.02544
      ppe-miR319b UAGCUGCCGAGUCAUUCAUCCA 22 0 0 2.036017143
      ppe-miR319c UUUGGACUGAAGGGAGCUCC 20 54.7699116 29.9171066 24.43220572
      ppe-miR319d CUUGGACUGAAGGGAGCUCCC 21 251.9415934 20.71184303 16.28813715
      ppe-miR319e CUUGGACUGAAGGGAGCUCCU 21 328.6194696 36.82105428 81.44068573
      ppe-miR319f UUUGGACUGAAGGGAGCUCUC 21 109.5398232 126.5723741 77.36865144
      ppe-miR3627-5p UCGCAGGAGAGAUGGCACUGUC 22 43.81592928 6.903947677 2.036017143
      ppe-miR390 AAGCUCAGGAGGGAUAGCGCC 21 153.3557525 2.301315892 0
      ppe-miR393a CAUCCAAAGGGAUCGCAUUGA 21 262.8955757 87.45000391 136.4131486
      ppe-miR393b UCCAAAGGGAUCGCAUUGAUC 21 306.711505 128.87369 215.8178172
      ppe-miR394a UUGGCAUUCUGUCCACCUCC 20 3,308.102661 3,516.410684 3,249.483361
      ppe-miR394b UUGGCAUUCUGUCCACCUCC 20 54.7699116 39.12237017 44.79237715
      ppe-miR395a-3p CUGAAGUGUUUGGGGGGACCC 21 898.2265503 2,908.863288 1,667.49804
      ppe-miR395c CUGAAGUGUUUGGGGGAACUC 21 65.72389392 174.9000078 215.8178172
      ppe-miR396a UUCCACAGCUUUCUUGAACGU 21 6,364.263728 59,399.2645 71,602.65089
      ppe-miR396b UUCCACAGCUUUCUUGAACUU 21 61,791.41427 484,650.223 540,299.9053
      ppe-miR396c UUCCACAGCUUUCUUGAACUG 21 12,421.81595 118,018.3829 109,040.9341
      ppe-miR397 UCAUUGAGUGCAGCGUUGAUG 21 43.81592928 85.14868802 46.8283943
      ppe-miR398a-5p GGAGCGACCUGGGAUCACAUG 21 6,484.757534 11,021.00181 2,640.714235
      ppe-miR398a-3p UGUGUUCUCAGGUCGCCCCUG 21 109.5398232 71.34079267 59.04449715
      ppe-miR398b CGUGUUCUCAGGUCGCCCCUG 21 1,654.05133 35,502.40027 37,275.40186
      ppe-miR398c UGUGUUCUCAGGUCACCCCUU 21 32.86194696 55.23158142 22.39618858
      ppe-miR399a CGCCAAAGGAGAGUUGCCCUU 21 0 34.51973839 114.01696
      ppe-miR399b UCUGCCAAAGGAGAAUUGCCC 21 32.86194696 27.61579071 73.29661716
      ppe-miR399c UGCCAAAGAAGAGUUGCCCUA 21 0 11.50657946 8.144068573
      ppe-miR403 UUAGAUUCACGCACAAACUCG 21 230.0336287 191.0092191 425.5275829
      ppe-miR477-5p ACUCUCCCUCAAAGGCUUCUAG 22 0 6.903947677 8.144068573
      ppe-miR477-3p CGAAGCCUUUGGGGAGAGUAA 21 87.63185856 561.5210778 486.6080972
      ppe-miR477a-3p GUUGGGGGCUCUUUUGGGACG 21 65.72389392 987.2645179 787.9386344
      ppe-miR477a-5p UCCCUCAAGGGCUCCCAAUAUU 22 0 64.43684499 103.8368743
      ppe-miR482a-3p UUUCCGAAACCUCCCAUUCCAA 22 3,833.893812 697.2987154 238.2140058
      ppe-miR482a-5p GGGUGAGAGGUUGCCGGAAAGA 22 449.1132751 98.95658337 42.75636001
      ppe-miR482b-5p GGAAUGGGAGGAUUGGGAAAA 21 12,750.43542 3,960.564651 2,972.585029
      ppe-miR482b-3p CUUCCCAAACCUCCCAUUCCUA 22 32.86194696 4.602631785 10.18008572
      ppe-miR482c-5p GGAAUGGGCUGUUUGGGAUG 20 755.8247801 409.6342289 191.3856115
      ppe-miR482c-3p UUCCCAAGCCCGCCCAUUCCAA 22 3,428.596466 554.6171301 555.8326801
      ppe-miR482e UUGCCUAUUCCUCCCAUGCCAA 22 942.0424795 849.1855643 572.1208173
      ppe-miR482f UCUUUCCUACUCCACCCAUUCC 22 8,839.863732 10,813.88338 16,467.30665
      ppe-miR5225-3p UCAUCUCUCCUCGACUGAA 19 21.90796464 0 0
      ppe-miR5225-5p UCUGUCGUAGGAGAGAUGGCGC 22 32.86194696 0 0
      ppe-miR530 UCUGCAUUUGCACCUGCACCU 21 87.63185856 23.01315892 30.54025715
      ppe-miR535a UGACAACGAGAGAGAGCACGC 21 76.67787624 62.1355291 12.21610286
      ppe-miR535b UGACGACGAGAGAGAGCACGC 21 197.1716818 186.4065873 77.36865144
      ppe-miR6257 UCUUAACUGUUGGAUUAGGCU 21 10.95398232 11.50657946 2.036017143
      ppe-miR6258 UUCCAGCUGUAAAGAUCAAGA 21 10.95398232 6.903947677 12.21610286
      ppe-miR6260 UGGAGUGAGAGAAUGGGAGGU 21 0 0 6.10805143
      ppe-miR6261 AAGUGAUUAUAUGGAGAAGCAC 22 0 0 2.036017143
      ppe-miR6263 AAGUGGACAAAAGGGGAGUGG 21 0 0 2.036017143
      ppe-miR6264 AUGCCUAUGGACACGUGUCAA 21 10.95398232 4.602631785 6.10805143
      ppe-miR6265 UUGAACUUUGACCCGAUUCGCAU 23 21.90796464 4.602631785 2.036017143
      ppe-miR6266a UAAAUGCAGGGGCAAAAUGAU 21 0 2.301315892 0
      ppe-miR6267a UAGAGAGGUGGUACAAUUGUG 21 10.95398232 0 0
      ppe-miR6267c-5p AUUGCUGAUCACCUCUCUAAU 21 21.90796464 59.8342132 185.27756
      ppe-miR6267c-3p UAGAGAGAUGGUCAGCAAUGU 21 21.90796464 27.61579071 105.8728914
      ppe-miR6270 UUCUGGUAUUGGAAUUUCAUU 21 142.4017702 18.41052714 40.72034287
      ppe-miR6271 UCAAGAUUGAGAGAUAUAAUG 21 0 0 8.144068573
      ppe-miR6274b-5p AUUUCGACUAAUAACACAAUG 21 0 2.301315892 2.036017143
      ppe-miR6274b-3p UUGUGUUAUUGGCCGAAAAUAG 22 208.1256641 18.41052714 46.8283943
      ppe-miR6277 UGUGUGUGGAAAGAGCGAGAC 21 21.90796464 9.20526357 12.21610286
      ppe-miR6280 UUGGCAGUAAGAUUUUUGGUG 21 10.95398232 0 0
      ppe-miR6281 GUUAGAGAUAGAGAGAGUGAG 21 76.67787624 52.93026553 69.22458287
      ppe-miR6282 GUUGAUCGAUGUGGGAUGUUACA 23 10.95398232 0 0
      ppe-miR6283 CAAAAGGGGAGUGGGAAAAUC 21 21.90796464 0 0
      ppe-miR6284 UUUGGACCAUGGAUGAAGAUU 21 98.58584088 29.9171066 20.36017143
      ppe-miR6285 UAGUGAAGUUUGAAUUAGGGCU 22 0 2.301315892 0
      ppe-miR6287 CAAGAAGUGGAAGUUUUGGGC 21 0 0 2.036017143
      ppe-miR6288a GAAAAUGACAAGUGGCUAGUU 21 0 2.301315892 2.036017143
      ppe-miR6288b-3p UCAAUUAGAAAAUGAUAAGUG 21 0 0 4.072034287
      ppe-miR6290 UGAAUGAGUUCAGAGAUCGUGUA 23 0 0 2.036017143
      ppe-miR6292 UAUCUUUUAAUCGUUAGAUCA 21 0 0 2.036017143
      ppe-miR6293 UAAGAGGCUGAUGACUAAAAC 21 65.72389392 46.02631785 61.0805143
      ppe-miR6294 UGGUGUAGGCUAAUCACAAUC 21 32.86194696 20.71184303 42.75636001
      ppe-miR6295 GAGGACAGAAGAUGAUUCAGC 21 32.86194696 13.80789535 20.36017143
      ppe-miR6297a AAUAAUUUUUCGUCGCGCAAAAU 23 32.86194696 20.71184303 8.144068573
      ppe-miR6297b GAUGUAUUGUCGUCGCGCAAAGU 23 0 0 2.036017143
      ppe-miR7122a-5p UUAUACAAUGAAAUCACGGCCG 22 251.9415934 69.03947677 83.47670287
      ppe-miR7122a-3p GCCGUGUUUCUUUGUAUAAAG 21 1,237.800002 1,456.73296 2,158.178172
      ppe-miR7122b-3p CCGUGUUUCCUUGUAUAAAG 20 0 2.301315892 8.144068573
      ppe-miR7122b-5p UUAUACAAUGAAAUCACGGUCG 22 32.86194696 46.02631785 140.4851829
      ppe-miR7125-3p CGAACUUAUUGCAACUAGCUU 21 0 27.61579071 8.144068573
      ppe-miR8122-5p UUCCACAGAUCUUUCCUCAUU 21 5,466.037178 1,233.505318 1,284.726817
      ppe-miR8122-3p UGAAGGAAGAUUUGUGGAAAG 21 887.2725679 667.3816088 637.2733658
      ppe-miR8124-3p UGGCACCAAUGAUACCAAGUUU 22 54.7699116 11.50657946 4.072034287
      ppe-miR8124-5p ACUUGGUAUCUUGGUGCCGGU 21 0 2.301315892 2.036017143
      ppe-miR8125 CAGGAAAGAAUGUGAUGAGUA 21 65.72389392 27.61579071 46.8283943
      ppe-miR8126-5p UCUGAGUCAGAUUACUGAAUA 21 10.95398232 4.602631785 8.144068573
      ppe-miR8126-3p UUCAGUAUUUUGACUCAGAA 20 21.90796464 23.01315892 42.75636001
      ppe-miR8127-3p UUCAAAGGGUACAUCCACAGU 21 10.95398232 0 0
      ppe-miR8128-5p AUUAGACCUCUCCCGACGAAA 21 21.90796464 43.72500196 63.11653144
      ppe-miR8128-3p UCGUGGGGAGAGAUCUAAUCG 21 0 0 4.072034287
      ppe-miR8130-5p GGGUUCCUUGUUGGAAGGACU 21 0 2.301315892 0
      ppe-miR8131-5p AUUUCAGCUAAGUUGAGUUGU 21 10.95398232 0 2.036017143
      ppe-miR8132 UCCAACGAUGGGUGACCACAA 21 10.95398232 2.301315892 10.18008572
      ppe-miR8133-5p UCCUGUGCGAACGUCCAGAAG 21 87.63185856 46.02631785 28.50424001
      ppe-miR8133-3p UAACUUCCGAACGUCCGCAUA 21 32.86194696 16.10921125 12.21610286
      ppe-miR827 UUAGAUGACCAUCAACAAACA 21 1,084.44425 409.6342289 309.4746058
      ppe-miR858 CUCGUUGUCUGUUCGACCUUG 21 10.95398232 4.602631785 2.036017143
      1 Length of miRNA; 2 the expression of transcripts per million.

      Figure 3. 

      Venn diagram of peach miRNAs among these libraries at DPA20, DPA50, and DPA75.

      These stage-specific miRNAs are likely to play regulatory roles during peach fruit development. Notably, expression levels of some members within known miRNA families varied significantly across growth stages. For example, eight members of the ppe-miR482 family were detected, while only one miRNA was identified for each of the other 41 families (Table 1).

      Among 86 novel miRNA sequences, 79 were detected in all three development stages, whereas one (novel_193) was specific to DPA50 fruit, and five (novel_100, novel_101, novel_197, novel_59, and novel_99) were detected in DPA50 and DPA75 fruits but not in DPA20. The characteristics of all 86 novel miRNAs are summarized in Supplementary Table S3. The lengths of these novel miRNAs varied from 20 to 25 nt, with the majority (64.0%) being 24 nt in length (64.0%). The precursor lengths varied from 52 to 293 nt, with an average minimum free energy (MFE) of −71.70 kCal/mol. Nucleotide bias analysis revealed that novel miRNAs with a uridine (U) residue at their 5' end were the most frequent (54.17%) among 20 to 25-nt miRNAs (Supplementary Fig. S2)[41].

    • The abundance of miRNA reads in a library reflects the relative expression levels of miRNAs. In this study, the transcripts per million (TPM) values of known and novel miRNAs ranged from 0 to 381,669.61 (ppe-miR159b) in DPA20, 0 to 484,650.22 (ppe-miR396b) in DPA50, and 0 to 540,299.90 (ppe-miR396b) in DPA75. The expression patterns of miRNAs varied widely, with TPM values spanning several orders of magnitude (Table 1; Supplementary Table S3). Among the novel miRNAs, novel_128 and novel_132 exhibited significantly higher expression levels compared to others, suggesting their potential importance in peach fruit development. Specifically, novel_128 showed the highest read counts in DPA75, while novel_132 was most abundant in DPA20. These findings indicate that novel_128 may play a critical role during the FWIII stage, whereas novel_132 is likely more important during the FWI stage. Among the known miRNAs, ppe-miR159b had the highest number of sequenced reads in DPA20, while ppe-miR396b dominated in DPA50 and DPA75, suggesting stage-specific regulatory roles for these miRNAs in peach development.

      To further elucidate the roles of miRNAs during fruit development, we analyzed their abundance patterns across the three stages. As shown in Supplementary Fig. S3, 210 miRNAs were categorized into four groups based on their accumulation trends. Some miRNAs, such as ppe-miR156a, ppe-miR156c, ppe-miR399a, ppe-miR395c, and ppe-miR398b, exhibited sustained increases across all three stages. In contrast, others, including ppe-miR160a, ppe-miR164d, ppe-miR166a, and ppe-miR171f, showed sustained decreases (Supplementary Fig. S3). Notably, different members of the same miRNA family displayed opposing expression trends. For example, ppe-miR164a expression increased by 3.7-fold at DPA50, while ppe-miR164d decreased by 4.7-fold compared to DPA20 levels. These observations highlight the functional diversity of miRNAs, even within the same family, during fruit development.

      To investigate the roles of miRNAs in peach fruit development, we performed differential expression analyses between adjacent stages (DPA50 vs DPA20 and DPA75 vs DPA50). MiRNAs were considered differentially expressed if |log2(fold change)| w >1 and the associated q-value was < 0.01. In the DPA50 vs DPA20 comparison, 97 miRNAs were differentially expressed, with 39 up-regulated and 58 down-regulated (Supplementary Table S3). Similarly, in the DPA75 vs DPA50 comparison, 79 miRNAs showed differential expression, with 43 up-regulated and 36 down-regulated (Supplementary Table S4). These results suggest that up-regulated miRNAs may positively correlate with fruit development, while down-regulated miRNAs may have negative regulatory roles.

    • MiRNAs can regulate multiple target genes, and conversely, a single gene can be regulated by multiple miRNAs[42]. Therefore, identifying miRNA targets is crucial for understanding their functional roles. In this study, we performed genome-wide degradome sequencing to identify miRNA-guided RNA cleavage targets. A total of 216 sliced target genes were identified for 74 known and eight novel miRNAs across the three libraries using the Cleave Land pipeline (Supplementary Tables S5). Specifically, 120, 139, and 157 target mRNAs were cleaved in the DPA20, DPA50, and DPA75 libraries, respectively. Based on the heights of the degradome peaks at each occupied transcript position, these cleaved targets were classified into the categories 0, 1, 2, 3, and 4 (Supplementary Table S5)[43]. Analysis of the cleavage products revealed that target genes regulated by single miRNAs exhibited varying expression levels across the three developmental stages, as illustrated in Fig. 4. Additionally, the cleavage frequencies of target genes varied significantly during different stages of peach development.

      Figure 4. 

      Abundance of miRNA and its target genes at different peach developmental stages. Normalized sequenced read abundance, height = transcripts per kilobase million reads (TPM) on the y-axis. The histogram represents the abundance of miRNA target genes and the dot linked by a line represent the abundance of miRNA.

      Among all target mRNAs which are cleaved by miRNAs, three MYB domain protein 30 were found to be the targets of ppe-miR159a, but not all the corresponding cleavage products were found at the three developmental stages (Supplementary Table S5). Notably, the cleavage products of Prupe.2G050100_v2.0. a1(GAM1) are present at all stages in greater abundance than Prupe.3G216600_v2.0.a1(GAM1) and Prupe.4G215500_v2.0.a1(GAM1) (Fig. 4; Supplementary Table S5). These observations differ from the findings of previous reports which failed to detect the cleavage products of the miR159a[44], likely reflecting different species and developmental stages. The miR160 family is known to target transcription factor genes of the ARF family, which are involved in the auxin signaling pathway during plant development[45]. Four ARF genes with cleavage products were detected across all three developmental stages, including Prupe.1G507000_v2.0.a1, which has been previously validated[44]. For ppe-miR167a, a different ARF family member (Prupe.3G011800_v2.0. a1) was identified as a target (Supplementary Table S5; Fig. 5), suggesting that ppe-miR167a also involved in auxin signaling during peach development.

      Figure 5. 

      Network analysis of miRNAs, targets, and GO terms involved in auxin signalling and fruit enlargement. Network analyses were performed using the Cytoscape network platform.

      In tomatoes, TIR1 and two TIR1 homologs have been identified as targets of miR393 family[41]. Here we found that TIR1 (Prupe.8G253300_v2.0.a1) and AFB2 (Prupe.3G311800_v2.0.a1) are targeted by ppe-miR393a and ppe-miR393b. However, the cleavage products of ppe-miR393b target genes were significantly more abundant, while no cleavage products of AFB2 (Prupe.3G311800_v2.0.a1) were detected for ppe-miR393a. These results suggest that ppe-miR393b plays a critical role in peach development, particularly during the FWI stage, with peak degradation occurring around 20 DPA, consistent with findings in tomatoes[42]. Additionally, two MYB domain protein genes were identified as targets of ppe-miR159b, similar to ppe-miR159a. Both miRNAs were found to cleave Prupe.2G050100_v2.0.a1 (GAM1) and Prupe.4G215500_v2.0.a1 (GAM1), confirming that a single miRNA can regulate multiple genes and that multiple miRNAs can collectively regulate a single gene[42].

    • We identified 216 target genes through degradome sequencing and performed Gene Ontology (GO) pathway analyses to elucidate their functional roles. Differentially expressed target genes in the DPA50 vs DPA20 comparison were classified into 382 GO terms, with 25 significantly enriched terms (p-value ≤ 0.05), including 13 biological processes, eight molecular functions, and four cellular components (Supplementary Table S6). Key enriched biological processes included cell differentiation (GO:0030154), auxin-activated signaling (GO:0009734), and leaf development (GO:0048366). In the cellular component category, the nucleus (GO:0005634), microtubule (GO:0005874), and endosome (GO:0005768) were predominant, while ADP binding (GO:0043531), ATP binding (GO:0005524), and metal ion binding (GO:0046872) were highly enriched in the molecular function category (Supplementary Table S6). The top 20 enriched GO terms for the DPA50 vs DPA20 comparison are illustrated in Supplementary Fig. S4a. Similarly, in the DPA75 vs DPA50 comparison, differentially expressed target genes were classified into 391 GO terms, with 27 significantly enriched terms (p-value ≤ 0.05), including 15 biological processes, nine molecular functions, and three cellular components (Supplementary Table S6). Key biological processes included transcription (GO:0006351), cell differentiation (GO:0030154), and auxin-activated signaling (GO:0009734). The cellular component category was dominated by the nucleus (GO:0005634), cytosol (GO:0005829), and extracellular region (GO:0005576), while ADP binding (GO:0043531), metal ion binding (GO:0046872), and DNA binding (GO:0003677) were highly enriched in the molecular function category (Supplementary Table S6). The top 20 enriched GO terms for the DPA75 vs DPA50 comparison are shown in Supplementary Fig. S4b. These results suggest that the targets of some miRNAs that were identified by degradome sequencing are involved in many biological processes during peach development.

      Our GO analyses revealed that the most enriched target mRNAs are associated with cell differentiation (GO:0030154) and auxin-activated signaling (GO:0009734), both of which are critical for peach fruit development. Congruently, fruit development is accompanied by constant division and differentiation of cells, and a previous report showed concordant effects of auxin on fruit enlargement[46]. To investigate the relationships among cell differentiation, auxin-activated signaling, ppe-miRNAs, and their targets, we conducted network analyses using the Cytoscape platform. This analysis included 23 miRNAs and 26 target genes known to be involved in cell differentiation, cell division, auxin transport, and auxin signaling (Table 2 & Fig. 5). The network revealed that a single pathway can be regulated by multiple miRNAs, and a single miRNA can influence multiple pathways, such as the auxin-activated signaling pathway. Specifically, we identified six ppe-miRNAs (ppe-miR160a, ppe-miR164a, ppe-miR164d, ppe-miR167a, ppe-miR393a, and ppe-miR393b) targeting 11 mRNAs, including auxin response factors, auxin receptor mRNAs, and NAC domain transcriptional regulators. For example, ppe-miR164d targets Prupe.4G143600_v2.0.a1 and Prupe.1G413900_v2.0.a1, both of which are involved in auxin signaling and cell differentiation. Similarly, ppe-miR160a targets Prupe.2G213000_v2.0.a1, Prupe.6G102800_v2.0.a1, and Prupe.6G236200_v2.0.a1, which are associated with auxin-activated signaling and cell division (Table 2 & Fig. 5). These findings demonstrate that a complex miRNA-mediated regulatory network governs multiple biological processes during peach development.

      Table 2.  The miRNA, target genes, and GO terms information used for network analysis.

      GO_IdGO_termmiRNADPA20_TPMDPA50_TPMDPA75_TPMTranscript_IDSymbolAnnoationDPA20_TPMDPA50_TPMDPA75_TPM
      GO:0009734Auxin-activated signaling pathwayppe-miR160a1,084.44425333.6908044177.1334915Prupe.1G507000_v2.0.a1ARF17Auxin response factor 32,936.9932492,693.3590615,571.987995
      Prupe.2G213000_v2.0.a1ARF18Auxin response factor 34,104.2597969,286.05885211,365.58915
      Prupe.6G102800_v2.0.a1ARF18Hypothetical protein78,884.62636112,477.890381,142.07518
      Prupe.6G236200_v2.0.a1ARF18Auxin response factor 310,806.62933,566.4897926,055.37568
      ppe-miR164a613.42300992,285.206681804.2267716Prupe.4G143600_v2.0.a1NAC021NAC domain-containing protein 89-like489.49887488,562.469855,160.4207
      ppe-miR164d10.953982322.3013158920Prupe.4G143600_v2.0.a1NAC021NAC domain-containing protein 89-like489.49887488,562.469855,160.4207
      ppe-miR167a1,424.017702352.1013315677.9937087Prupe.3G011800_v2.0.a1ARF8Auxin response factor 19-like1,845.034224,502.33156512,663.60908
      ppe-miR393a262.895575787.45000391136.4131486Prupe.3G311800_v2.0.a1AFB2Protein TRANSPORT INHIBITOR RESPONSE 1-like0120.59816690
      Prupe.8G253300_v2.0.a1TIR1Hypothetical protein37.6537596120.5981669221.6131589
      ppe-miR393b306.711505128.87369215.8178172Prupe.3G311800_v2.0.a1AFB2Protein TRANSPORT INHIBITOR RESPONSE 1-like4,367.8361139,848.85029719,406.98092
      Prupe.8G253300_v2.0.a1TIR1Hypothetical protein6,137.56281432,923.2995757,841.03448
      GO:0010928regulation of auxin mediated signaling pathwayppe-miR394b54.769911639.1223701744.79237715Prupe.1G224600_v2.0.a1FBX6978.99774954,140.5370647,408.211312
      ppe-miR394a3,308.1026613,516.4106843,249.483361Prupe.1G224600_v2.0.a1FBX6978.99774954,140.5370647,408.211312
      GO:0009733response to auxinppe-miR167a1424.017702352.1013315677.9937087Prupe.3G011800_v2.0.a1ARF8Auxin response factor 19-like1,845.034224,502.33156512,663.60908
      ppe-miR160a1,084.44425333.6908044177.1334915Prupe.2G213000_v2.0.a1ARF18Auxin response factor 34,104.2597969,286.05885211,365.58915
      Prupe.6G236200_v2.0.a1ARF18Auxin response factor 310,806.62933,566.4897926,055.37568
      ppe-miR85810.953982324.6026317852.036017143Prupe.7G201600_v2.0.a1C1Transcription factor MYB75-like040.19938897886.4526356
      ppe-miR166a18,358.874377,847.4871933,273.915566Prupe.1G447100_v2.0.a1ATHB-8414.19135562,170.7670042,421.915237
      ppe-miR319a164.309734829.9171066171.02544Prupe.4G171100_v2.0.a1PCF5112.9612788094.9770681
      GO:0060918Auxin transportppe-miR164d10.953982322.3013158920Prupe.1G413900_v2.0.a1SF2137.653759600
      GO:2000012Regulation of auxin polar transportppe-miR482d-3p000Prupe.8G259700_v2.0.a1OsI_027940Uncharacterized protein OsI_027940-like37.6537596120.598166931.6590227
      GO:0030154Cell differentiationppe-miR319c54.769911629.917106624.43220572Prupe.4G083500_v2.0.a1TCP20063.3180454
      ppe-miR319e328.619469636.8210542881.44068573Prupe.4G083500_v2.0.a1TCP20063.3180454
      ppe-miR164d10.953982322.3013158920Prupe.1G413900_v2.0.a1SF2137.653759600
      ppe-miR166a18,358.874377,847.4871933,273.915566Prupe.1G447100_v2.0.a1ATHB-8414.19135562,170.7670042,421.915237
      Prupe.3G060700_v2.0.a1ATHB-15414.19135562,170.7670042,421.915237
      Prupe.4G090100_v2.0.a1ATHB-14941.3439899924.5859463569.8624086
      Prupe.6G102300_v2.0.a1REV715.42143241,165.782281,677.928203
      ppe-miR171b120.493805523.0131589230.54025715Prupe.5G072300_v2.0.a1SCL6Hypothetical protein715.4214324442.1932787348.2492497
      ppe-miR171f295.7575226133.476321867.18856573Prupe.5G072300_v2.0.a1SCL6Hypothetical protein0241.19633381,171.38384
      ppe-miR171h635.3309746211.721062124.43220572Prupe.5G072300_v2.0.a1SCL6Hypothetical protein715.4214324442.1932787348.2492497
      ppe-miR172a-3p120.493805520.7118430312.21610286Prupe.6G091100_v2.0.a1RAP2-737.6537596200.9969448284.9312043
      Prupe.6G231700_v2.0.a1AP2Uncharacterized LOC106378603376.5375961,045.1841133,609.128588
      Prupe.6G242400_v2.0.a1AP20094.9770681
      ppe-miR172c32.861946964.60263178516.28813715Prupe.6G091100_v2.0.a1RAP2-737.6537596200.9969448284.9312043
      Prupe.6G231700_v2.0.a1AP2Uncharacterized LOC106378603376.5375961,045.1841133,609.128588
      Prupe.6G242400_v2.0.a1AP20094.9770681
      ppe-miR172d65.723893922.3013158924.072034287Prupe.6G091100_v2.0.a1RAP2-737.6537596200.9969448284.9312043
      Prupe.6G231700_v2.0.a1AP2Uncharacterized LOC106378603376.5375961,045.1841133,609.128588
      Prupe.6G242400_v2.0.a1AP20094.9770681
      ppe-miR319a164.309734829.9171066171.02544Prupe.3G124900_v2.0.a1TCP437.6537596063.3180454
      Prupe.4G083500_v2.0.a1TCP275.307519280.39877794664.8394767
      Prupe.4G171100_v2.0.a1PCF5112.9612788094.9770681
      ppe-miR396a6364.26372859399.264571602.65089Prupe.1G531300_v2.0.a1AGL24D-3-phosphoglycerate dehydrogenase093.79857426164.626918
      GO:0045597Positive regulation of cell differentiationppe-miR166a18,358.874377,847.4871933,273.915566Prupe.1G447100_v2.0.a1ATHB-8414.19135562,170.7670042,421.915237
      GO:0051301Cell divisionppe-miR160a1,084.44425333.6908044177.1334915Prupe.2G213000_v2.0.a1ARF18Auxin response factor 34,104.2597969,286.05885211,365.58915
      Prupe.6G102800_v2.0.a1ARF18Hypothetical protein78,884.62636112,477.890381,142.07518
      Prupe.6G236200_v2.0.a1ARF18Auxin response factor 310,806.62933,566.4897926,055.37568
      ppe-miR171b120.493805523.0131589230.54025715Prupe.2G138400_v2.0.a1SCL6DELLA protein GAI 137.653759600
      ppe-miR171h635.3309746211.721062124.43220572Prupe.2G138400_v2.0.a1SCL6DELLA protein GAI 137.653759600
      GO:0008284Positive regulation of cell proliferationppe-miR166a18,358.874377,847.4871933,273.915566Prupe.1G447100_v2.0.a1ATHB-8414.19135562,170.7670042,421.915237
      GO:0008285Negative regulation of cell proliferationppe-miR396a6,364.26372859,399.264571,602.65089Prupe.1G419000_v2.0.a1GRF61,242.5740676,070.1077344,558.899269
      ppe-miR396b61,791.41427484,650.223540,299.9053Prupe.1G419000_v2.0.a1GRF61,242.5740676,070.1077344,558.899269
      ppe-miR396c12,421.81595118,018.3829109,040.9341Prupe.1G419000_v2.0.a1GRF61,242.5740676,070.1077344,558.899269
    • To validate the deep sequencing data, we employed the RLM-5'RACE approach to confirm four targets of ppe-miR160a and two targets of ppe-miR393a/b. Additionally, the expression levels of five miRNAs and their corresponding target genes were analyzed using qRT-PCR. For this validation, we selected five conserved miRNAs (ppe-miR159b, ppe-miR160a, ppe-miR167a, ppe-miR393a, and ppe-miR393b) and their target mRNAs, including auxin response factors, TIR proteins involved in auxin signaling, and MYB domain proteins. As shown in Fig. 6, five miRNAs showed differential expression patterns during fruit development. The expression levels of ppe-miR160a and ppe-miR159b gradually decreased throughout fruit development, while ppe-miR167a, ppe-miR393a, and ppe-miR393b showed an initial decline from DPA20 to DPA50, followed by an increase from DPA50 to DPA75 (Fig. 6). These expression patterns align with our high-throughput sequencing data (Table 1; Supplementary Table S3) and are consistent with previous studies highlighting the critical roles of ppe-miR160, ppe-miR167, and ppe-miR393 in auxin signaling[44].

      Figure 6. 

      Expression patterns of the four miRNAs identified and their target genes during fruit development and ripening; U6 and RPII were used as reference genes for miRNA and target genes, respectively.

      To further confirm the regulatory roles of these miRNAs, we examined the expression patterns of nine target genes corresponding to the five miRNAs using qRT-PCR at the same developmental stages (Fig. 6). As expected, the expression patterns of the miRNAs and their target genes exhibited an inverse relationship. This finding was supported by degradome sequencing data, which revealed abundant cleavage products for these target genes (Supplementary Table S5). Additionally, RLM-5'RACE results confirmed the same cleavage sites for four targets of ppe-miR160a and two targets of ppe-miR393b (Supplementary Fig. S5, Supplementary Tables S7 & S8), further validating the reliability of the degradome sequencing data.

    • Numerous studies have highlighted the critical roles of miRNAs in fruit development[10,11,18,22,23]. Peach fruits are well-known to exhibit a double-sigmoid growth pattern, characterized by three distinct stages: FWI, FWII, and FWIII. While Zhu et al.[18] identified miRNAs in peach fruits using a mixed fruit sample, their analysis was limited to a single mixed library, leaving the dynamic regulation of miRNAs across sequential developmental stages largely unexplored. In this study, we conducted a comprehensive analysis of peach miRNAs and their targets across three key developmental stages, representing the double-sigmoid growth curve, through small RNA (sRNA) and degradome sequencing. Integrative analyses revealed that miRNA-mediated regulatory networks play a pivotal role in peach growth and development. However, the lack of biological replicates in our study presents a limitation in distinguishing true biological variations from technical noise. Future studies incorporating multiple replicates are essential to validate our findings and provide a more robust understanding of miRNA expression dynamics during peach fruit development.

    • Numerous fruit development-associated miRNAs have been identified in fruit-producing plants, including grape[16,17], apple[15], citrus[22], and peach[18]. In this study, 124 known miRNAs were detected across three small RNA libraries, with 85 miRNAs present in all three libraries. Previous studies have shown clear functional dose effects of miRNAs and suggested that highly and/or specifically expressed miRNAs are more likely to play versatile biological roles than with low abundance[47,48]. For example, in Hami melon, the miR159 and miR396 families exhibited high redundancy in their respective small RNA libraries[49]. Similarly, in our datasets, ppe-miR396b accounted for the highest proportion of normalized reads across all three libraries, representing approximately 50% of the known miRNA reads. In contrast, ppe-miR159a accounted for about 21% of conserved reads (Table 2), suggesting that both ppe-miR396b and ppe-miR159a play critical roles during peach development. Interestingly, in a mixed peach library from 'Troubadour', the ppe-miR156 family was the most abundantly expressed. However, in our study, ppe-miR156 was detected only in the DPA50 and DPA75 libraries, with no reads detected in the DPA20 library. This discrepancy suggests that single miRNAs may have distinct roles in different cultivars or developmental stages. Additionally, we identified 86 novel miRNAs, 79 of which were detected across all three libraries, while novel_193 was specific to the DPA50 library. The total number of novel miRNAs was lower than that of known miRNAs, and their absolute sequencing frequencies were considerably reduced, with most novel miRNAs exhibiting relatively low TPM values. This observation aligns with previous studies[50,51], which have shown that species-specific novel miRNAs often have low sequencing frequencies and exhibit more spatiotemporal expression patterns compared to conserved miRNAs.

      Differences in miRNA expression profiles may reflect their regulatory roles in peach development. In this study, 97 and 79 miRNAs were differentially expressed in the DPA50 vs DPA20 and DPA75 vs DPA50 comparisons, respectively (Supplementary Table S4), indicating their involvement in cellular and developmental processes. Notably, some miRNAs were detected exclusively in one of the three developmental stages (Supplementary Table S4), suggesting that specific miRNAs may exhibit unique expression patterns during certain stages, enabling them to perform diverse regulatory functions in peach fruit development.

    • It has been proposed that plant miRNAs mediate gene expression mainly via miRNA-guided cleavage of target transcripts[51]. Therefore, identifying miRNA targets is a critical step in understanding the regulatory roles of miRNAs. In this study, degradome sequencing identified 216 cleaved targets for 74 known and eight novel miRNAs across the three developmental stages (Supplementary Table S5). Notably, the degradation levels of these targets varied across the three stages, suggesting that miRNAs may play distinct roles at different phases of peach fruit development. For example, the target genes of ppe-miR172a-3p, which encode RAP2-7 and AP2, showed an increasing abundance of degradome tags as fruit development progressed. This indicates that RAP2-7 and AP2 are actively targeted by ppe-miR172a-3p during fruit development and ripening. Many conserved miRNA targets, particularly transcription factors, regulate diverse physiological processes, and genetic programs[4750]. In this study, the majority of targets for peach miRNAs were also conserved. For instance, the miR156 family is known to target SQUAMOSA promoter binding protein-like (SPL) transcription factors[42,44]. In the present experiments, six SPL transcription factors genes were identified as targets of ppe-miR156a/c/f. Similarly, the miR166 family has highly conserved targets encoding class III homeodomain leucine zipper (HD-ZIP III) transcription factors, which are involved in various developmental processes across plant species[5254]. We predicted that four HD-ZIP III family members are the targets of ppe-miR166a and except ATHB-14, the cleavage products of REV, ATHB-8, and ATHB-15 are present in much greater quantities during FWII and FWIII than during FWI. This finding confirms that ppe-miR166a promotes late-stage development of fruits and may contribute to the fine-tuning of HD-ZIP III proteins. In addition to conserved targets, some miRNAs were found to have novel or additional targets in peach. For example, the miR396 family, known to target growth-regulating factor (GRF) genes, also targeted D-3-phosphoglycerate dehydrogenase, animal HSPA9 nucleotide-binding domain protein, and hypothetical proteins such as DAP and WEB1. Furthermore, 21 targets were detected for the eight novel miRNAs, many of which are involved in diverse biological processes. Specifically, 17 targets were identified for ppe-miR396a, including nine GRF genes, DNA topoisomerase 3-alpha, and other proteins. These findings suggest that miRNA-target interactions may exhibit species-specific characteristics during peach development.

    • Auxin has long been considered a central regulator of ovary wall enlargement and pericarp development, and synthetic auxins have been shown to enhance fruit growth by stimulating fruit cell enlargement in peaches[54]. miRNAs have been shown to directly and indirectly regulate the auxin signaling pathway. For instance, the miR160 family targets auxin response factors (ARF10, ARF16, and ARF17) in multiple plant species[41,45,55], while the miR167 family regulates ARF6 and ARF8 to control reproductive processes[45,55]. Additionally, the miR393 family regulates the expression of the auxin receptor TIR1 and related auxin signaling F-box proteins AFB1, AFB2, and AFB3 in Arabidopsis and peaches[56]. In peaches, ppe-miR160a targets ARF17 to regulate peach development during the hard-core stage[44], and the miR164 family negatively regulates a subset of NAC transcription factor family members, which are auxin-responsive and the key regulators of plant growth and development[57]. Our sequencing data show that ppe-miR160a, ppe-miR167a, ppe-miR393a/b, and ppe-miR164a/d regulate auxin signaling by targeting ARFs, auxin receptor TIR1, auxin signaling F-box proteins (AFB2), and NAC transcription factors (Fig. 7; Supplementary Table S5). Specifically, ARF17 (Prupe.1G507000_v2.0.a1), ARF18 (Prupe.6G102800_v2.0.a1, Prupe. 2G213000_v2.0.a1, and Prupe.6G236200_v2.0.a1), and ARF8 (Prupe.3G011800_v2.0.a1) were identified as targets gene of ppe-miR160a and ppe-miR167a, with cleavage products varying across developmental stages. These indicates that the targets of single miRNAs play different roles in peach developmental stages. Both ppe-miR393a and ppe-miR393b target the TIR1/AFB2 Auxin Receptor Clade (Table 2), as observed in Arabidopsis[56], but ppe-miR393b exhibited significantly stronger degradation effects on TIR1/AFB2 than ppe-miR393a across all stages. Furthermore, NAC021, a target of ppe-miR164a, was implicated in auxin signaling, with its cleavage products more abundant during FWII and FWIII than FWI. These findings collectively demonstrate that miRNAs regulate peach fruit development by modulating auxin signaling.

      Figure 7. 

      A schematic model of the proposed roles of miRNAs in the early development of peaches; T bars and arrows refer to negative and positive effects on downstream effectors or biological process, respectively; scale bar = 1 cm

      Fruit enlargement, a critical developmental process in peach and other fruiting plants, requires precise control of cell proliferation, expansion, and differentiation. To better understand the roles of miRNAs in peach enlargement, we analyzed miRNAs involved in cell proliferation and differentiation (Fig. 7; Table 2). For example, ppe-miR319c/e targets TCPs, which promote cell expansion and repress cell proliferation[58]. In our study, TCP2 cleavage products were more abundant during FWIII than FWI and FWII (Supplementary Table S5). Additionally, ppe-miR396a targets GRFs were detected, and these have been previously shown to regulate the growth of citrus fruits and leaves[59]. We also confirmed conserved interactions, such as ppe-miR172 a-3p/c/d targeting AP2 and ppe-miR166a targeting HD-ZIP III genes (ATHB8, ATHB14, ATHB15, and REV). In agreement, sl-miR172 targeting SlAP2a negatively regulated ethylene production during tomato ripening[60], and ppe-miR166a targeting the four HD-ZIP III subfamily genes ATHB8, ATHB14, ATHB15, and REV reportedly influences peach enlargement[44]. Notably, ppe-miR171b/f/h targeting SCL6 was implicated in cell division, a novel finding not previously reported. The MADS-box protein, encoded by AGL24 reportedly promotes flowering in Arabidopsis and was targeted by ppe-miR396a, which is also involved in cell differentiation (Fig. 7). Finally, ppe-miR160-ARF interactions, previously linked to fruit enlargement through auxin signaling, were also observed[44].

    • Using high-throughput RNA sequencing, we identified 124 conserved and 86 novel miRNAs in peach. Moreover, 216 sliced targets for 74 known and eight novel miRNAs were identified by degradome sequencing. Subsequent miRNA–gene–GO term network analyses highlighted a complex miRNA regulatory network involved in auxin signaling, which plays a central role in peach enlargement (Fig. 5). Collectively, these findings provide a foundation for future studies on miRNA-mediated mechanisms underlying peach development.

      • This work was supported by the Natural Science Foundation of Jiangsu (BK20201176 and BK20190542), Jiangsu University 'Qinglan Project' (2022). We thank Professor Chen Wang for her support and cooperation throughout this research.

      • The authors confirm contribution to the paper as follows: experiments conception and design: Zhang Y; experiments performing: Zhu X; data analysis: Wang C; manuscript writing: Zhang Y, Ge M. All authors reviewed the results and approved the final version of the manuscript.

      • The authors declare that they have no conflict of interest.

      • Supplementary Table S1 Statistical analysis of the sequencing reads from peach sRNA and degradome libraries; DPA, days post-anthesis.
      • Supplementary Table S2 Characteristics of novel peach miRNAs from DPA20, DAP50 and DPA75 libraries.
      • Supplementary Table S3 Differentially expressed peach miRNAs in DPA50 vs. DPA20 and DPA75 vs. DPA50 libraries; |log2(fold change)| > 1 and q-value < 0.01.
      • Supplementary Table S4 Summary of the ppe-miRNAs targets identified by degradome sequencing at DPA 20, DPA50 and DPA75.
      • Supplementary Table S5 Enrichment of differentially expressed target genes in DPA50 vs. DPA20 and DPA75 vs. DPA50 libraries; Threshold p-value ≤ 0.05.
      • Supplementary Table S6 Details of the ppe-miRNAs targets identified by degradome sequencing at DPA 20 and DPA50.
      • Supplementary Table S7 Details of the ppe-miRNAs targets identified by degradome sequencing at DPA 50 and DPA75.
      • Supplementary Table S8 Primers used for qRT-PCR analyses and RLM-5'RACE.
      • Supplementary Fig. S1 Changes in the longitudinal and transverse diameters of 'Baifeng' peach during different developmental stages.
      • Supplementary Fig. S2 Proportion of the first nucleotide bias within novel miRNAs of the same length in the three libraries of peach sRNAs
      • Supplementary Fig. S3 Expression analysis of the known and novel peach miRNAs identified by sequencing analyses; miRNAs were grouped into four classes (I–IV) based on their accumulation patterns. DPA20, DPA50 and DPA75 indicate 20, 50 and 75 days post anthesis, respectively.
      • Supplementary Fig. S4 Significantly enriched GO terms for the target genes of peach miRNAs in DPA50 vs. DPA20 (a) and DPA75 vs. DPA50 (b) libraries; enriched factors were calculated according to the numbers of differentially expressed genes which were mapped to GO term divided by the numbers of all genes in that GO term; the top 20 enriched GO terms are listed.
      • Supplementary Fig. S5 Target plot (t-plots) of peach miRNA targets and validation of target genes by RLM-5'RACE. The red line represents the sliced target transcripts. miRNA: mRNA alignments along with the miRNA-directed cleavage positions are shown below. Watson-Crick pairing (vertical dashes) and G:U wobble pairing (circles) are indicated and the numbers show the frequency of clones sequenced.
      • Copyright: © 2025 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (7)  Table (2) References (60)
  • About this article
    Cite this article
    Zhang Y, Zhu X, Wang C, Ge M. 2025. Characterisation of early fruit development-specific miRNAs and their targets in peach using small RNA and degradome sequencing. Fruit Research 5: e021 doi: 10.48130/frures-0025-0010
    Zhang Y, Zhu X, Wang C, Ge M. 2025. Characterisation of early fruit development-specific miRNAs and their targets in peach using small RNA and degradome sequencing. Fruit Research 5: e021 doi: 10.48130/frures-0025-0010

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return